ID: 1043778195

View in Genome Browser
Species Human (GRCh38)
Location 8:84297198-84297220
Sequence GAGGGTAGACAGTGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4857
Summary {0: 1, 1: 36, 2: 310, 3: 1385, 4: 3125}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043778195_1043778201 -10 Left 1043778195 8:84297198-84297220 CCCTCCTCCCACTGTCTACCCTC 0: 1
1: 36
2: 310
3: 1385
4: 3125
Right 1043778201 8:84297211-84297233 GTCTACCCTCAAGTAGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043778195 Original CRISPR GAGGGTAGACAGTGGGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr