ID: 1043781364

View in Genome Browser
Species Human (GRCh38)
Location 8:84339790-84339812
Sequence GTTGTCTTGTGAGCAGAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043781364_1043781367 29 Left 1043781364 8:84339790-84339812 CCTAGTTCTGCTCACAAGACAAC 0: 1
1: 0
2: 1
3: 10
4: 153
Right 1043781367 8:84339842-84339864 AGTTGTTCTTTCATTTTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043781364 Original CRISPR GTTGTCTTGTGAGCAGAACT AGG (reversed) Intronic
900341815 1:2193163-2193185 GTTATCTTGTTAGCAAAACTGGG + Intronic
900841601 1:5052901-5052923 GTTGTCTGGTGGGCAGGAGTGGG - Intergenic
901093710 1:6661594-6661616 GTTGTCTTGTAAGGAGAAAAGGG - Intronic
902042800 1:13504963-13504985 GAAGTCGTGGGAGCAGAACTGGG - Intronic
902741581 1:18442206-18442228 GTTGCCTTGAGACCAGAACATGG - Intergenic
903199725 1:21725236-21725258 ATTTTCTTGGTAGCAGAACTTGG - Intronic
903427559 1:23265698-23265720 ATTGTCTTGAGAGCAAAATTAGG - Intergenic
904642199 1:31938904-31938926 TGTGTCTTGTGGGCAGAGCTGGG - Intronic
904736853 1:32641235-32641257 ATTGAGTTGTGAGCTGAACTAGG - Intronic
904843208 1:33387619-33387641 GTTGTCTTGTGAGAAAAATGAGG - Intronic
906632902 1:47387439-47387461 GTGGGCTTGAGGGCAGAACTAGG + Intergenic
909787814 1:79638936-79638958 GTTCTCTTGTGGGCAGGAGTGGG + Intergenic
918151716 1:181802644-181802666 GTTGTCTTGCGAGGAGCACCAGG - Intronic
918308894 1:183271396-183271418 TTTGAATTGTGAGCAGGACTGGG - Intronic
922153598 1:223024574-223024596 GTTCTCTGGTGAGCAGGAGTGGG + Intergenic
923992025 1:239449124-239449146 CTTGTCCTGTGAGCAGAACATGG + Intronic
924485471 1:244479262-244479284 GTTGTATTTTGAGCAGAGATGGG + Intronic
1064983026 10:21183130-21183152 GTTTTCATGTCAGCAGAATTTGG - Intergenic
1071674757 10:87644988-87645010 GTTGTGTTGTGAGCTGCCCTAGG - Intergenic
1076477321 10:130761789-130761811 GTTGGTTTGTGAGGAGAAATTGG + Intergenic
1077730135 11:4721771-4721793 GTTCTCTTGTGAGCTGACTTGGG + Intronic
1079705434 11:23611077-23611099 GTTGTGTTGTGTGTAGAGCTGGG + Intergenic
1080902244 11:36506485-36506507 TTTGTCTTGTGGCCAGCACTTGG - Intronic
1084721625 11:70909555-70909577 GTTGTCTGATGTGCAGAACAAGG - Intronic
1085569915 11:77550415-77550437 GTTCTCTTGTGGGCAGGAGTGGG - Intronic
1085738619 11:79060925-79060947 CTTTTCTTGTGATGAGAACTCGG - Intronic
1090344523 11:126058510-126058532 ACTGTATTGTGAGGAGAACTTGG + Intronic
1092697676 12:11191409-11191431 TTTGTCTTATGAATAGAACTTGG + Intergenic
1093321524 12:17720427-17720449 GTTCTCTGGTGGGCAGGACTGGG + Intergenic
1093892204 12:24535407-24535429 TTTCTTTTGTGAGAAGAACTAGG + Intergenic
1100922271 12:99501541-99501563 GATTTTTTGTGAGCAGAACAAGG - Intronic
1100938628 12:99700079-99700101 GTTGTCTTCTGTGCAAACCTTGG - Intronic
1102248105 12:111367900-111367922 TTTGCCTTGGGAGCAGAGCTGGG - Intronic
1102568917 12:113815501-113815523 GGTGGCATGTGAGCAGAGCTGGG - Intergenic
1102775523 12:115515482-115515504 GTTTTCATGGGAGCAGATCTGGG + Intergenic
1109352735 13:61205894-61205916 GTTCTCTTGTGGGCAGGAGTGGG - Intergenic
1112954215 13:105039569-105039591 GTTCTATAGTGAGCTGAACTGGG - Intergenic
1113692292 13:112319505-112319527 GTGTTCCTGTGAGCTGAACTTGG + Intergenic
1115020491 14:28674235-28674257 GTTGTCCAGGGAGAAGAACTGGG + Intergenic
1116999472 14:51357477-51357499 GTGGACTTGTGGGCAGAAGTAGG + Intergenic
1117598565 14:57349446-57349468 CTTCTCTTGTGTGCAGAAGTGGG - Intergenic
1119759031 14:77138759-77138781 GGTGACATGTAAGCAGAACTGGG + Intronic
1120327569 14:83050219-83050241 GTTGTTTTGTGACCCCAACTTGG + Intergenic
1126201876 15:45995660-45995682 GTTGTATTATGAACTGAACTTGG + Intergenic
1127134847 15:55909516-55909538 GTTGTCTTGTCAGCATACCCTGG - Intronic
1127222779 15:56897815-56897837 AGTGTCTTGAGAGCAGAACATGG + Intronic
1129605423 15:77022747-77022769 CTTGTTGTGTGAGCTGAACTAGG + Intronic
1130649952 15:85756789-85756811 GTTGTCTAATGAGCACAGCTTGG - Intergenic
1130826268 15:87549474-87549496 GTTCTCTTTTGTGGAGAACTTGG + Intergenic
1133241961 16:4419845-4419867 GTTTTGTTGTGAGAAGACCTGGG + Intronic
1133887636 16:9845510-9845532 GGTGTTCTTTGAGCAGAACTTGG - Intronic
1134467362 16:14491349-14491371 GTTGTCTTCTGAACAGGACCAGG + Intronic
1138155440 16:54698705-54698727 GATGTGTTGTGGCCAGAACTGGG + Intergenic
1139394072 16:66626110-66626132 GTTGACTTGTTAGAAAAACTGGG - Intronic
1139872956 16:70122293-70122315 GTTGTCTTGTGATCAGACTTGGG + Intronic
1140362823 16:74359018-74359040 GTTGTCTTATGATCAGACTTGGG - Intergenic
1141151374 16:81566645-81566667 GTTCTCTTGGGAACAGAATTGGG - Intronic
1142361538 16:89629962-89629984 GTTGTCTTGCTTGCAGATCTAGG + Intronic
1143307798 17:5961311-5961333 GTTGACTTGTGAGCAGGAAGCGG + Intronic
1144064050 17:11608428-11608450 GTAGGCTTGTGTGCAGAACGAGG - Intronic
1145926966 17:28655167-28655189 GTTCTCTTTTGTGCAGACCTGGG - Intronic
1148134692 17:45284688-45284710 TCTGACTTGTGAACAGAACTTGG - Intronic
1148607497 17:48941231-48941253 GTTCTGTTGTCAGCAGAAATGGG + Intronic
1148699484 17:49579128-49579150 GTGGTCTCGGGAGCAGATCTTGG - Exonic
1152497710 17:80685841-80685863 GTCGTCCTGGGAGCAGCACTCGG + Intronic
1152573135 17:81129153-81129175 GTTGACGTGGGAGCAGAATTCGG - Intronic
1153525965 18:5994808-5994830 GTATTCCTGAGAGCAGAACTGGG - Intronic
1155826182 18:30446177-30446199 GTTCTCTAGTGAACAAAACTTGG - Intergenic
1156093141 18:33495424-33495446 GATGTTTTGTGAGCAGGAATGGG - Intergenic
1156301959 18:35844312-35844334 GTTCTCTGGTGAGCAGGAGTGGG - Intergenic
1158990874 18:62867168-62867190 GTTGTCTAGGGAGCAGGACTTGG - Intronic
1167626087 19:50590318-50590340 ATGGTCATGTGAGCAAAACTGGG + Intergenic
926455477 2:13062256-13062278 GCTTTCATGTGAGCATAACTTGG - Intergenic
926879655 2:17530051-17530073 CTTGTTCTGTGAGAAGAACTGGG - Intergenic
927087530 2:19686698-19686720 GCTGTCTAGTGGACAGAACTAGG - Intergenic
927214889 2:20662706-20662728 GTTGTCTTGTCATCAGACATGGG + Intergenic
927972050 2:27312028-27312050 TTTTTCTTGTGTGCAGAAGTTGG - Intronic
930341363 2:50119680-50119702 TTTGCCTTGTTAGCAGAATTAGG - Intronic
932391835 2:71398392-71398414 GGTGTCATGTCAGCAGCACTCGG + Intronic
932812949 2:74839494-74839516 GTTGTCTTCTGAGCAGAGAAAGG - Intronic
943241642 2:185391899-185391921 GTTGTCTGCTGAGAAGAAATTGG + Intergenic
943389567 2:187247107-187247129 CTTGTCTTGTGAGCATAAAATGG + Intergenic
945123896 2:206487523-206487545 GATGTCTGGTGAGCAGCTCTGGG - Intronic
945362493 2:208908170-208908192 GTTCTCTGGTGAGCAGTAGTGGG - Intergenic
1171385347 20:24766017-24766039 GTGGGCCTGTGAGCAGAGCTTGG - Intergenic
1171991601 20:31700789-31700811 AGTATCTTGAGAGCAGAACTGGG + Intronic
1173755341 20:45510941-45510963 GTTGCCTTGCCAGCATAACTTGG + Intergenic
1173925465 20:46778161-46778183 GGTGTCTTGTGAGTAGAATCTGG - Intergenic
1174888773 20:54366584-54366606 ATTCACTTGTGAGCAGAATTTGG - Intergenic
1175980123 20:62734524-62734546 GTTCTCTGCTGAGCAGAGCTGGG + Intronic
1177100288 21:16892422-16892444 GTTCTCTGGTGGGCAGGACTGGG - Intergenic
1178600345 21:33988982-33989004 GTTTTCTTGTCAGCAAAACTGGG + Intergenic
1179310869 21:40195319-40195341 GTTTTCTTTTCAGCAGAACCAGG - Intronic
1181113417 22:20615772-20615794 TGTGTCTTCTGAGCATAACTTGG - Intergenic
1182260046 22:29067613-29067635 TTTGTATTTTTAGCAGAACTGGG + Intergenic
1183537863 22:38413569-38413591 GCTGCCTTGTGACCAGACCTTGG + Intergenic
1183847022 22:40550258-40550280 GTTTTTTTGTTGGCAGAACTTGG + Intronic
950874469 3:16257642-16257664 ATTGTCTTCTGACCAGAGCTGGG + Intergenic
953260684 3:41336191-41336213 GTTTTCCTGGTAGCAGAACTGGG - Intronic
953431231 3:42842182-42842204 GTTTTCTTGTGAAAGGAACTGGG + Intronic
960089096 3:113620910-113620932 CTTGTCTTGTGAGCAGATCGTGG - Intronic
961109039 3:124268217-124268239 GTGGTATGGTGAACAGAACTAGG - Intronic
961950678 3:130746507-130746529 GTGGTCCTGGGAGGAGAACTGGG + Exonic
967667816 3:192195047-192195069 GTTGTCTTGGAGCCAGAACTAGG + Intronic
970594207 4:17585005-17585027 GTTTGCTTCTGGGCAGAACTTGG + Exonic
972324691 4:38004291-38004313 GTGGTCTAGTAAGCAGTACTGGG + Intronic
975373593 4:73615893-73615915 GTTGCCTTGTGACCAGAATGAGG + Intronic
976739391 4:88343014-88343036 GTTGTCTTGTGGGCAGGGGTGGG - Intergenic
976749492 4:88439718-88439740 GTTGTATTGTGACCAAAACCTGG - Intronic
977718679 4:100212838-100212860 GGTGTCTAGTGAGCAGGGCTAGG + Intergenic
983807901 4:172018012-172018034 GTTGTCATGTGAACAGATTTGGG + Intronic
984927990 4:184823559-184823581 GTTGTCTTGTCATTATAACTGGG - Intronic
985710157 5:1423367-1423389 GCTGTCTTGTGGGCAGCAGTGGG - Intronic
986825390 5:11515323-11515345 GTGGTCTTGTCAGCAGAAAGAGG - Intronic
990818221 5:59808838-59808860 GTTGTCTTTACAGAAGAACTTGG - Intronic
992096756 5:73369968-73369990 GTTGTCTTGTGAGCAGACACAGG - Intergenic
993095421 5:83473653-83473675 CAAGTCTTGTGAGCTGAACTGGG - Intronic
994132335 5:96244682-96244704 GCTTTGTAGTGAGCAGAACTGGG - Intergenic
1000790717 5:165603423-165603445 GATGTTTTGTGACCAGAAATAGG + Intergenic
1002303505 5:178270571-178270593 GTGGTCTTTAGAGAAGAACTGGG - Intronic
1005127891 6:22469946-22469968 GTTGTCTTGATACCAAAACTTGG - Intergenic
1006786907 6:36674296-36674318 GTTTGCTTCTGGGCAGAACTTGG + Intergenic
1006903373 6:37517012-37517034 GCTGTCTGCTGAGCTGAACTAGG - Intergenic
1007251036 6:40495180-40495202 GTTGTCTGGTGAGGAGGACCAGG - Intronic
1007566144 6:42852122-42852144 GTGGTCTTGGGAGCAGAAATGGG - Exonic
1008850987 6:56021254-56021276 GTAGTCTTCTGACCTGAACTGGG + Intergenic
1009545332 6:65012640-65012662 TTTTTCTTGTGGTCAGAACTGGG - Intronic
1010024051 6:71195358-71195380 GTTATCTTGGGAGCAGAGTTGGG + Intergenic
1010331976 6:74633834-74633856 CTTGTTTGGTGTGCAGAACTTGG + Intergenic
1010976896 6:82325530-82325552 AGTGTTTTGTGAGCAGAATTAGG + Intergenic
1012875774 6:104724022-104724044 ATGCTCTTGTGAGCTGAACTAGG - Intergenic
1013408249 6:109861345-109861367 GTTCTCTGGTGAGCAGGAGTGGG + Intergenic
1015484613 6:133754495-133754517 GTTGTCTAGTGAGCGGAGCCAGG + Intergenic
1015863190 6:137701832-137701854 GTTGTCCTGAGAGCAGAAGCAGG + Intergenic
1016560573 6:145391772-145391794 GTTGTCTTGCCAGCTGCACTGGG + Intergenic
1018084048 6:160286778-160286800 GTTCTCTGGTGAGCAGGAGTGGG + Intergenic
1019219757 6:170464175-170464197 GGTGTCTTGTGAGCAGCACTGGG + Intergenic
1022252475 7:28622162-28622184 GTTTTCCTGTGAGCGAAACTTGG + Intronic
1024586139 7:50843713-50843735 GAAGTCTTGTGAGAAGAAATGGG + Intergenic
1030674591 7:112371125-112371147 GTGTCCTTGTGGGCAGAACTAGG + Intergenic
1033506103 7:142002080-142002102 CTTCTCTTCTGAGAAGAACTTGG + Intronic
1034400068 7:150856404-150856426 GTTGTCTTATGGGCAGAGATGGG - Intronic
1034468736 7:151244896-151244918 GGTGGCTTGAGAGCAGACCTGGG + Intronic
1035557863 8:579839-579861 GGTGTGTTGTGAGCAGCACTGGG + Intergenic
1036985538 8:13525003-13525025 GTTGCCTTGGGAGCAGAAGAAGG - Intergenic
1038721029 8:30035469-30035491 GTTCTCTGGTGGGCAGAAGTGGG - Intergenic
1039222971 8:35355885-35355907 GTTGTCTTGAAAGCAGAGATGGG + Intronic
1039854057 8:41397549-41397571 GCTGTCTTTTGAGAAGAATTTGG - Intergenic
1041312605 8:56531897-56531919 GTTTTGCTGTGAGGAGAACTTGG + Intergenic
1043584855 8:81756832-81756854 ATTGTTTTGTGAGCAGAAATAGG + Intronic
1043781364 8:84339790-84339812 GTTGTCTTGTGAGCAGAACTAGG - Intronic
1043800883 8:84608270-84608292 GTGGGCTTGTGGACAGAACTTGG + Intronic
1045175148 8:99714701-99714723 GTTTTCTTGTGATCAGAAAGAGG - Intronic
1050013143 9:1205882-1205904 ATTGTCTTGGGAGCAGAGCATGG + Intergenic
1050906281 9:11011150-11011172 TTTGACTTGTAAGCAGTACTAGG - Intergenic
1052207708 9:25863423-25863445 GTTGTATAGTGAGGAAAACTTGG + Intergenic
1053352528 9:37422969-37422991 GTCGTCTTAAGAGGAGAACTGGG - Intronic
1055882258 9:81015085-81015107 GTTCTCTGGTGAGCAGGAGTGGG - Intergenic
1056244508 9:84680852-84680874 CTTGACTTCTTAGCAGAACTTGG + Intronic
1057067971 9:92072999-92073021 GGTGGCTTGTGGGTAGAACTCGG - Intronic
1061852064 9:133422183-133422205 GCTGTCTGGTGTGCAGGACTGGG + Exonic
1186876213 X:13820571-13820593 GATGGCATTTGAGCAGAACTGGG - Intronic
1188525828 X:31086792-31086814 TTTGTCTTGTGATCACAATTTGG + Intergenic
1189547197 X:42053700-42053722 TTTTTCTTTTTAGCAGAACTGGG + Intergenic
1191011591 X:55765306-55765328 GTTGGCTTGGAATCAGAACTGGG - Intergenic