ID: 1043783412

View in Genome Browser
Species Human (GRCh38)
Location 8:84365901-84365923
Sequence GTGGTCTAGTACCAGCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 99}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043783412_1043783414 -8 Left 1043783412 8:84365901-84365923 CCCTGCTGCTGGTACTAGACCAC 0: 1
1: 0
2: 0
3: 11
4: 99
Right 1043783414 8:84365916-84365938 TAGACCACACACTGACCGCATGG No data
1043783412_1043783416 1 Left 1043783412 8:84365901-84365923 CCCTGCTGCTGGTACTAGACCAC 0: 1
1: 0
2: 0
3: 11
4: 99
Right 1043783416 8:84365925-84365947 CACTGACCGCATGGACACGTTGG No data
1043783412_1043783418 7 Left 1043783412 8:84365901-84365923 CCCTGCTGCTGGTACTAGACCAC 0: 1
1: 0
2: 0
3: 11
4: 99
Right 1043783418 8:84365931-84365953 CCGCATGGACACGTTGGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043783412 Original CRISPR GTGGTCTAGTACCAGCAGCA GGG (reversed) Intronic
902936592 1:19769186-19769208 GTGGTCTGGCGCCAGCTGCAAGG - Intronic
903278390 1:22236185-22236207 GGGGCCAAGAACCAGCAGCAAGG + Intergenic
905141956 1:35853703-35853725 GTGGTCTTCTACCAGCAGCTCGG + Exonic
905850658 1:41272170-41272192 GGGGTCTGGCACCAGAAGCAGGG - Intergenic
911184243 1:94887407-94887429 GTGGTATGGTACCTGCAGGAAGG + Intronic
916775597 1:167960493-167960515 GTGGTCTCGAACCACCAGCCAGG + Intronic
921272587 1:213485997-213486019 GTGGCCCAGAAACAGCAGCAAGG - Intergenic
922959630 1:229635382-229635404 GGGCTCTTGGACCAGCAGCAAGG + Exonic
923301776 1:232648085-232648107 GAGGTCCAGCACCAGAAGCATGG - Intergenic
923889480 1:238196444-238196466 TTGATCTAGTATCAGCAGCCAGG - Intergenic
1067043509 10:42970920-42970942 GAGGCCTGGTGCCAGCAGCACGG - Intergenic
1067352965 10:45493691-45493713 GTGGTCTGGGGACAGCAGCATGG - Intronic
1068733368 10:60385006-60385028 GTGTTGTAGCAGCAGCAGCAGGG - Intronic
1073085457 10:100885565-100885587 CAGGTCTAGTACCAGCTGGAAGG + Intergenic
1075445021 10:122507015-122507037 GGATTCTAGTGCCAGCAGCATGG + Intronic
1078330685 11:10416903-10416925 GTGGAATAGAGCCAGCAGCACGG - Intronic
1081078752 11:38712144-38712166 GTGGTCCAGTACCTGCAGGAGGG - Intergenic
1088064817 11:105704160-105704182 GTTGACTAATACAAGCAGCATGG - Intronic
1093537928 12:20244964-20244986 GTGATCTGGCACCAGGAGCAAGG + Intergenic
1096692802 12:53331518-53331540 TTGGCCTGGTAGCAGCAGCATGG - Intronic
1105558365 13:21466751-21466773 GTGGTCTCTTACCAGGAGAAAGG - Intergenic
1105567727 13:21567408-21567430 GTGGTCAAGGAACAGCAGAAAGG + Intronic
1107943297 13:45394117-45394139 GTAGTTTAGAACAAGCAGCAAGG + Exonic
1108686973 13:52828118-52828140 GAGCTCTGGCACCAGCAGCAGGG + Intergenic
1111844107 13:93487633-93487655 GTGGTCAAGTAAAAGCAACAAGG - Intronic
1113724955 13:112591791-112591813 CTGGTGTAGTACCAGCATTAAGG - Intergenic
1114222730 14:20711467-20711489 GTGCTGAAGTACCAGCAGCGGGG + Intergenic
1114243811 14:20893880-20893902 GTGATCTGGTACCTGAAGCAAGG - Intergenic
1122011192 14:98750273-98750295 ATGTTCTAAAACCAGCAGCATGG - Intergenic
1122198427 14:100107277-100107299 GTGGTCGAGTGCCATCAGCTTGG - Intronic
1124718601 15:32091962-32091984 GTTTTCTAGGACCAGAAGCAGGG + Intronic
1127020206 15:54738239-54738261 GTGATGTAGTACCAGAAGCAGGG - Intergenic
1130089007 15:80803626-80803648 ATGGTCTAGAACCAACTGCATGG - Intronic
1130860045 15:87877688-87877710 ATGGTTTAGTGCAAGCAGCAGGG - Intronic
1136169787 16:28482093-28482115 GGGGTTTGGTACCTGCAGCAGGG + Exonic
1142275210 16:89114810-89114832 GTGGTCTGGAGCCAACAGCATGG - Intronic
1149647784 17:58252630-58252652 GTGGTCCAGGACTAGCAGAAGGG + Intronic
1152427744 17:80227677-80227699 GTGGTCTGGGACCAGCAGCCTGG + Intronic
1152428103 17:80229765-80229787 GTGGCCTGGGACCAGCAGCCTGG + Intronic
1154197433 18:12276866-12276888 GTGGTCTTGGGCCAGCAGCAAGG + Intronic
1156992572 18:43426866-43426888 GTGTGTTAGCACCAGCAGCACGG - Intergenic
1157041344 18:44043250-44043272 CTGATCTAGTACCACCAGAATGG - Intergenic
1158529116 18:58242414-58242436 GTGGTTAAGTACCAGCTGAAAGG + Intronic
1159059866 18:63503365-63503387 GTGGACTAATCCCAGCACCATGG + Exonic
925177761 2:1797184-1797206 GTGGCCCAGCACCAGCAGAACGG - Intronic
929913992 2:46118472-46118494 GTGATCTGGTATCAGAAGCAAGG + Intronic
931396845 2:61895454-61895476 ATGGTCTAGTAGCAGGACCAAGG - Intronic
932300785 2:70665573-70665595 GAGGTCCAGGACCAGCAGCTTGG - Intronic
934747435 2:96768843-96768865 GTGGTCCAGGGCCAGCAGCATGG - Intronic
937091012 2:119206199-119206221 GTGATCTAAGATCAGCAGCATGG + Intergenic
938487212 2:131723555-131723577 CTGGTCTACCACCAGCAGCCTGG - Intronic
939042199 2:137203512-137203534 TTGGCCTAGAACCAGGAGCATGG - Intronic
939288033 2:140157560-140157582 GTGGTCCAGTTACAGCAGGAGGG - Intergenic
945206289 2:207335569-207335591 GTGGTCCAATGCCAGAAGCAAGG - Intergenic
948469184 2:238166526-238166548 GTGGTCATGCACCAGCAGCGTGG - Intronic
1171813145 20:29761922-29761944 GAGGTCCAGTACCCGCAGCACGG + Intergenic
1173498059 20:43533373-43533395 GTGGGCTGGTGCCAGAAGCAAGG + Exonic
1180648396 22:17358752-17358774 GTGCTTTAGTAACAGCTGCAAGG - Intergenic
1181013358 22:20054838-20054860 GTGGTATAGTGCTGGCAGCATGG + Intronic
1182873659 22:33671204-33671226 GTGGTGTACTTCCTGCAGCAGGG - Intronic
1184543164 22:45143434-45143456 GTGGTGTAGTCCCAGCAACTTGG + Intergenic
950565897 3:13769464-13769486 GTGGTCTAGAAGGAACAGCAAGG - Intergenic
951453750 3:22867841-22867863 GTGGTCTTAGACCAGCAGCATGG - Intergenic
953267724 3:41408993-41409015 GTGCTCTAGTCCCAGCACCTTGG + Intronic
953955834 3:47231327-47231349 GTGGTCCTGGACTAGCAGCATGG + Intronic
960891700 3:122455320-122455342 GTGGTTTAGTAGCAGCAGGGAGG + Intronic
961325770 3:126108430-126108452 GAGGCCTTGTACCAGGAGCAGGG - Intronic
963442697 3:145359279-145359301 GAGGTCTAGAACCAGAAGCAGGG - Intergenic
968950209 4:3687604-3687626 GTGGTCTAGAAGCACCAGCGTGG + Intergenic
970201561 4:13613404-13613426 GTGGTATAGTAGCAAGAGCATGG - Intronic
970478332 4:16448319-16448341 TTGGTCTAGTACCAGAACCTGGG + Intergenic
973847978 4:54932433-54932455 GTGGTCTAGAAGCAGCACCAAGG - Intergenic
978428788 4:108610446-108610468 GTGGTCAAGGACCAGAAGCATGG + Intergenic
978997232 4:115171890-115171912 GTGCTCTAGTAGCAGTATCAGGG - Intergenic
982159367 4:152552515-152552537 ATGGTCTAGTACCACCAACCTGG + Intergenic
982788379 4:159561767-159561789 GTGTCCCAGTTCCAGCAGCAAGG + Intergenic
987262617 5:16219013-16219035 ATGGTTTAGTACCATCAGCTTGG + Intergenic
997528609 5:134568888-134568910 GTGGCCCAGTGCCAGCAGCCGGG + Intronic
1001579537 5:172789458-172789480 GTGGCTTAGGACCAGCACCAAGG - Intergenic
1008534169 6:52494421-52494443 ATGGGCTAGAAACAGCAGCATGG - Exonic
1008583727 6:52929994-52930016 GTGGCCCTGGACCAGCAGCATGG - Intergenic
1008792645 6:55256395-55256417 GTGTTCTAGTACAAACACCAAGG - Intronic
1020195907 7:6038906-6038928 GTGTTGTAATACCAGCAGAAGGG + Intronic
1020841531 7:13224012-13224034 GTGGTAAAGTGGCAGCAGCAGGG + Intergenic
1032147070 7:129393693-129393715 GTGATCTTGTACCAAAAGCAAGG - Intronic
1032177770 7:129646578-129646600 GTGGTTGAGTACCAGCTGAATGG - Intronic
1034619353 7:152445415-152445437 ATGCTCTAGAAACAGCAGCAGGG - Intergenic
1034843201 7:154418874-154418896 GTGTTCAAGTACCACCAGCCAGG + Intronic
1038952957 8:32435530-32435552 GTGCTCCAGTAACAGCAGAAGGG - Intronic
1039018773 8:33182735-33182757 GTGATCTAGTGCTAGCAGTAAGG + Intergenic
1039918309 8:41875697-41875719 GTGTTCTTCTACGAGCAGCAAGG - Intronic
1041906960 8:63043841-63043863 GAGGTCTAGTACCAGGCCCATGG - Intergenic
1043783412 8:84365901-84365923 GTGGTCTAGTACCAGCAGCAGGG - Intronic
1045190448 8:99876976-99876998 GTGGTGTAGTCCCAGCTGCTTGG - Exonic
1046212080 8:111089479-111089501 GGGGTCTAATACCAGGTGCATGG - Intergenic
1048346982 8:133583376-133583398 GTGGTCTAGCTCCAGAAGTAAGG + Intergenic
1048867612 8:138772246-138772268 GTGAGCTGGTACCTGCAGCATGG - Intronic
1050676018 9:8053783-8053805 GTGGTCTTGTGCAAGAAGCAAGG - Intergenic
1053425380 9:38006740-38006762 GAGGCTTAGTGCCAGCAGCACGG + Intronic
1055923657 9:81488540-81488562 GGGCTCCAGGACCAGCAGCACGG + Intergenic
1056901884 9:90607563-90607585 GTGGTCTCAGACCAGAAGCAGGG + Intergenic
1058871133 9:109202562-109202584 GTGGTTTACTAACACCAGCAGGG - Intronic
1059308380 9:113372163-113372185 GTGTTCTGGTGCCAGCAGCTAGG - Intergenic
1062105839 9:134754346-134754368 GTGGTTTAGTGACAGCAGCTTGG + Intronic
1186218978 X:7329041-7329063 CTGGACTAGTACCAGGAGCTAGG - Intronic
1194279450 X:91930787-91930809 GTTGTCTGGTTCCAGCATCAAGG - Intronic
1195894087 X:109727530-109727552 GTGGTCTAGGAGCAGCAATAAGG - Intronic
1196745104 X:119064768-119064790 TTGGACTAGTACCATCAGCTAGG - Intergenic
1199253286 X:145689469-145689491 GTGGTTTAGTACCAGCCTCTTGG + Intergenic
1200274009 X:154714809-154714831 GTGGTAAAGAGCCAGCAGCAAGG + Intronic
1200596925 Y:5154286-5154308 GTTGTCTGGTTCCAGCATCAAGG - Intronic