ID: 1043783413

View in Genome Browser
Species Human (GRCh38)
Location 8:84365902-84365924
Sequence TGTGGTCTAGTACCAGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 84}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043783413_1043783418 6 Left 1043783413 8:84365902-84365924 CCTGCTGCTGGTACTAGACCACA 0: 1
1: 0
2: 0
3: 10
4: 84
Right 1043783418 8:84365931-84365953 CCGCATGGACACGTTGGCATTGG No data
1043783413_1043783414 -9 Left 1043783413 8:84365902-84365924 CCTGCTGCTGGTACTAGACCACA 0: 1
1: 0
2: 0
3: 10
4: 84
Right 1043783414 8:84365916-84365938 TAGACCACACACTGACCGCATGG No data
1043783413_1043783416 0 Left 1043783413 8:84365902-84365924 CCTGCTGCTGGTACTAGACCACA 0: 1
1: 0
2: 0
3: 10
4: 84
Right 1043783416 8:84365925-84365947 CACTGACCGCATGGACACGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043783413 Original CRISPR TGTGGTCTAGTACCAGCAGC AGG (reversed) Intronic
900170431 1:1265492-1265514 TGTGCTCCATTCCCAGCAGCAGG - Intronic
900601093 1:3502929-3502951 AGAGGTTTAGTTCCAGCAGCAGG - Intronic
901571962 1:10168126-10168148 TGTGTCCTAGGATCAGCAGCAGG + Exonic
902089685 1:13893240-13893262 TGTGTTCCAGCACCAGCTGCCGG - Intergenic
911249135 1:95555278-95555300 TGTGTTCAAGTACCCACAGCTGG + Intergenic
912378890 1:109235831-109235853 TGTGGTCCAGTCCCAGTTGCTGG + Intronic
918230125 1:182521672-182521694 TATGGTCTAGTAAAAGCAGCTGG + Intronic
924511231 1:244730551-244730573 CGCGGTCCAGCACCAGCAGCGGG + Intergenic
1067412088 10:46073856-46073878 TGTGGTGTAGTCCCAGCTACTGG + Intergenic
1070468940 10:76758138-76758160 TGTGGTCTAATACTCACAGCCGG + Intergenic
1071519140 10:86318238-86318260 TGTGTTCTAGCAGCTGCAGCAGG - Intronic
1077382528 11:2250899-2250921 TGTGGTGTAGGCCCAGCAGAGGG + Intergenic
1079823314 11:25159636-25159658 TGGGCTCTAGAATCAGCAGCTGG + Intergenic
1080052404 11:27870834-27870856 TGTGGTCAGCAACCAGCAGCAGG + Intergenic
1080638818 11:34146617-34146639 TGTGGACTTGTACCTGGAGCAGG + Exonic
1081078753 11:38712145-38712167 TGTGGTCCAGTACCTGCAGGAGG - Intergenic
1082868520 11:57921151-57921173 TCTGGGGTAGTAGCAGCAGCAGG - Intergenic
1088886820 11:114014239-114014261 TGTGTTCTACTTGCAGCAGCAGG + Intergenic
1096114257 12:49046047-49046069 TGTGGGTGAGTACCAGCTGCTGG - Exonic
1100916717 12:99432114-99432136 TGTGATGTATCACCAGCAGCTGG + Intronic
1107409056 13:40141590-40141612 TGTGGTCTAGAAACATCACCAGG - Intergenic
1109466262 13:62736109-62736131 TGTGGTCTAGAAAGAACAGCTGG + Intergenic
1114222729 14:20711466-20711488 TGTGCTGAAGTACCAGCAGCGGG + Intergenic
1117615754 14:57532184-57532206 TGGGGTCTAGTAGCAGGAGGAGG - Intergenic
1118197495 14:63641337-63641359 TGTGGTATGATACCAGCAACTGG - Intronic
1123486305 15:20742748-20742770 TGTGGACCAGTGCCAGCTGCAGG - Intergenic
1123542796 15:21311804-21311826 TGTGGACCAGTGCCAGCTGCAGG - Intergenic
1124718600 15:32091961-32091983 TGTTTTCTAGGACCAGAAGCAGG + Intronic
1127020207 15:54738240-54738262 GGTGATGTAGTACCAGAAGCAGG - Intergenic
1129915376 15:79265520-79265542 TTTGGTCTTGAAACAGCAGCTGG + Intergenic
1202951114 15_KI270727v1_random:38934-38956 TGTGGACCAGTGCCAGCTGCAGG - Intergenic
1132829308 16:1919645-1919667 TCTGGACAAGTCCCAGCAGCCGG + Intergenic
1136137126 16:28263214-28263236 TGTGGGCTAGCACCAGAAACTGG + Intergenic
1140074497 16:71684812-71684834 TTTGCTCTATCACCAGCAGCTGG + Intronic
1142769473 17:2086231-2086253 TTTGGTCTAGAACCAGCAGAGGG + Intronic
1146902605 17:36598406-36598428 TGTTGTCAAGTACCAGCCCCTGG + Intronic
1147186151 17:38714067-38714089 TGTGTTCTAGAACCAGGAGATGG + Intronic
1149379211 17:56076267-56076289 TCTGGTATAGTAGCAGCACCTGG - Intergenic
1150386797 17:64767822-64767844 TGGGGTCTGGTGGCAGCAGCTGG - Intergenic
1150386836 17:64768026-64768048 TGGGGTCTGGTAGCAGCGGCTGG - Intergenic
1158533365 18:58283645-58283667 TGTTGTGTAGCACCAGCAGCTGG - Intronic
1160619074 18:80157925-80157947 TGTGGTCCAGCACCACCTGCTGG - Exonic
1161240650 19:3221495-3221517 TGTGGTCTTGCACCAGCCACTGG + Intergenic
1164494372 19:28746005-28746027 TGTGGACCAGTAGCAGCATCTGG + Intergenic
929087487 2:38182833-38182855 TGTCAGCTAGTAGCAGCAGCAGG + Intergenic
935860009 2:107319410-107319432 CATGGTCTGGTAGCAGCAGCAGG - Intergenic
936382834 2:112002520-112002542 TGTTGTGTGGTAGCAGCAGCCGG - Intronic
939288034 2:140157561-140157583 TGTGGTCCAGTTACAGCAGGAGG - Intergenic
940430424 2:153583876-153583898 TTGGTTCTAGCACCAGCAGCTGG - Intergenic
942866779 2:180686004-180686026 TCTGATCTAGTGCCAGCAGGGGG + Intergenic
946277429 2:218642192-218642214 GGTGATCTAGTACCAGCTGATGG + Exonic
946744641 2:222833292-222833314 TGTAGTCAAGTATCACCAGCTGG - Intergenic
1169570073 20:6896765-6896787 TGGGGTCTCCTACCAGCAGAAGG + Intergenic
1169733265 20:8809939-8809961 TGTGAGCTAGTACTAGCAGCAGG - Intronic
1172976202 20:38907834-38907856 TGTGTTTTAGCTCCAGCAGCAGG - Exonic
1175758385 20:61544659-61544681 TGTGGTCAAGTACAGGCAGGGGG - Intronic
1179344716 21:40546037-40546059 TGTGATCTGGTACCAGGACCTGG + Intronic
1181568388 22:23753067-23753089 TGTGTCCTGGTACCAGCAGCGGG - Exonic
952738731 3:36715480-36715502 TGGGGTCTACCACCAGCAACCGG + Exonic
954739407 3:52736001-52736023 TGTGGTCTAGTAGGAGAAGTGGG + Intronic
963442698 3:145359280-145359302 AGAGGTCTAGAACCAGAAGCAGG - Intergenic
970251227 4:14118045-14118067 TGTGGTCTAGTTCCAGGAAGTGG + Intergenic
970478331 4:16448318-16448340 CTTGGTCTAGTACCAGAACCTGG + Intergenic
970599084 4:17626792-17626814 TGTGTTCTACAAACAGCAGCTGG + Exonic
975510352 4:75188022-75188044 TGTGTTCTAGTTCCAGAACCTGG - Intergenic
979955736 4:126951682-126951704 TGTTTTCAAGTACCAGCAGTGGG + Intergenic
981941651 4:150287694-150287716 TGTAGGCTAGGTCCAGCAGCTGG - Intronic
984472209 4:180190639-180190661 TGTGGTGTAACACCAGAAGCAGG - Intergenic
995588806 5:113676723-113676745 TGTGCCCTCCTACCAGCAGCAGG - Intergenic
995918418 5:117279529-117279551 TGTGGGCAACTACCAGAAGCTGG - Intergenic
996749350 5:126873473-126873495 CGTGGTCCTGGACCAGCAGCAGG + Intronic
997528608 5:134568887-134568909 CGTGGCCCAGTGCCAGCAGCCGG + Intronic
1001265198 5:170269126-170269148 TGTGGTCTGGTAACAGAAGTTGG - Intronic
1005379768 6:25221966-25221988 TGTGACCTAGTACCTGGAGCAGG + Intergenic
1005755696 6:28923596-28923618 TGTGGCCGAGTGCCTGCAGCAGG - Exonic
1016665263 6:146632237-146632259 TGTGGTCAAGTTCCAGAAGCTGG - Intronic
1017599091 6:156061384-156061406 CCTGGTCTAGTAACTGCAGCAGG - Intergenic
1019128064 6:169854427-169854449 TGTGGGCTGGTCCCAGCACCAGG - Intergenic
1019631008 7:2049823-2049845 TGTGGTCTGGTGCCCGCAGATGG - Intronic
1021573123 7:22084772-22084794 TCTGGTGTTGTACCAGCAGCAGG + Intergenic
1023089616 7:36605461-36605483 TGTCCTCTAGTTGCAGCAGCAGG + Intronic
1042632671 8:70836987-70837009 TGTGGTCAAGTAGCAGTAGTGGG - Intergenic
1043783413 8:84365902-84365924 TGTGGTCTAGTACCAGCAGCAGG - Intronic
1044841418 8:96339998-96340020 TGTGGTCTGAGAACAGCAGCAGG - Intergenic
1046056387 8:109083779-109083801 TGTGGTCTATTGGGAGCAGCAGG - Intergenic
1047816967 8:128475199-128475221 AGTGGTCAAGTAAAAGCAGCTGG + Intergenic
1048653768 8:136512080-136512102 AGTGTTTTGGTACCAGCAGCAGG + Intergenic
1048749947 8:137661627-137661649 TGTGGTCTGGATCCAACAGCAGG - Intergenic
1051997751 9:23238498-23238520 AGTCGTCTAGTAACAGCAGCTGG - Intergenic
1056901883 9:90607562-90607584 TGTGGTCTCAGACCAGAAGCAGG + Intergenic
1185779398 X:2831163-2831185 TGTGGTCTGGTACAAGAAGGAGG - Intronic
1186507863 X:10108553-10108575 TGAGGTCTAGACCCAGCAGGTGG + Intronic
1192237656 X:69306131-69306153 GTTGGTCCAGTACCAGGAGCTGG + Intergenic
1196189376 X:112779041-112779063 TGTGGTCCAGGACCGGTAGCTGG + Exonic
1201290653 Y:12419298-12419320 TGTGGTCTAGTACAAAAAGGAGG + Intergenic