ID: 1043783418

View in Genome Browser
Species Human (GRCh38)
Location 8:84365931-84365953
Sequence CCGCATGGACACGTTGGCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043783413_1043783418 6 Left 1043783413 8:84365902-84365924 CCTGCTGCTGGTACTAGACCACA 0: 1
1: 0
2: 0
3: 10
4: 84
Right 1043783418 8:84365931-84365953 CCGCATGGACACGTTGGCATTGG No data
1043783412_1043783418 7 Left 1043783412 8:84365901-84365923 CCCTGCTGCTGGTACTAGACCAC 0: 1
1: 0
2: 0
3: 11
4: 99
Right 1043783418 8:84365931-84365953 CCGCATGGACACGTTGGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043783418 Original CRISPR CCGCATGGACACGTTGGCAT TGG Intronic
No off target data available for this crispr