ID: 1043784254

View in Genome Browser
Species Human (GRCh38)
Location 8:84377308-84377330
Sequence TTAGCCCACATGATATTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043784254 Original CRISPR TTAGCCCACATGATATTTTG AGG (reversed) Intronic
908084114 1:60611894-60611916 TTGGCCCAGATGCTATTTTCTGG + Intergenic
909583809 1:77266791-77266813 ATAGACCACATGGTAATTTGAGG + Intergenic
911578795 1:99611287-99611309 TTAGTCTGCATGATATTTTCAGG - Intergenic
912149875 1:106845322-106845344 TTAGTCTTCATGATATTCTGTGG + Intergenic
918103236 1:181394744-181394766 TTAGCCAGAATGATATTTAGGGG + Intergenic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
919368763 1:196699408-196699430 TGAGACTACATGATATATTGTGG + Intronic
919744797 1:201002072-201002094 TTAGTCCACCTGATACTCTGGGG + Intronic
920012932 1:202883099-202883121 TTGGCTGGCATGATATTTTGCGG - Intronic
920828236 1:209442515-209442537 TTGGCCCACATGATTTTAAGTGG + Intergenic
1065825693 10:29568681-29568703 TTAGCACCCATAATATTCTGTGG + Intronic
1068507287 10:57917464-57917486 TTTGCCCACATAATTTTTTAAGG + Intergenic
1070352543 10:75607018-75607040 GAAGCCCAAATGATATTTTATGG + Intronic
1070779165 10:79127543-79127565 CCAGCCCACTTGATATTATGAGG - Intronic
1071988223 10:91073940-91073962 ATAGCCCTCGTGTTATTTTGGGG - Intergenic
1080497544 11:32834551-32834573 GTAGTTCACATTATATTTTGGGG - Intronic
1082151102 11:48739743-48739765 TTAGTCCTTATGATAGTTTGCGG - Intergenic
1085916466 11:80894391-80894413 TTGGCCCACATTCTAATTTGAGG + Intergenic
1088497965 11:110451221-110451243 TTAGCCAACATTATTTTTTATGG - Intronic
1090601728 11:128379276-128379298 TTAGCCCACATCATACCTTCTGG + Intergenic
1091161466 11:133425344-133425366 TTGACCCACAAGCTATTTTGTGG + Intronic
1094766601 12:33602776-33602798 TAAACCCACATGCTATCTTGGGG + Intergenic
1097918581 12:65046632-65046654 TTAACCCAAAAGATAATTTGGGG - Intergenic
1101067513 12:101038256-101038278 TGAAGCCACATGATGTTTTGGGG - Intronic
1102801122 12:115734918-115734940 TGAGCGCACATGTTATTTTGAGG - Intergenic
1105688220 13:22807584-22807606 TTACCTCACATTTTATTTTGTGG - Intergenic
1106578157 13:30995025-30995047 AAAGCCCTCATGATATTTTCAGG - Intergenic
1107465236 13:40643755-40643777 TTAGCACACCTGAGATTCTGGGG - Intronic
1108923612 13:55708526-55708548 TTTACCGACATCATATTTTGTGG - Intergenic
1111360864 13:87173787-87173809 TTTGGCCACATGAAATATTGTGG + Intergenic
1111672133 13:91345845-91345867 TTAGCCAACTTGATGTTTTTTGG - Intergenic
1113178771 13:107600425-107600447 TTAACCTACATAATAGTTTGAGG - Intronic
1114249243 14:20943950-20943972 TGTGCTCACATGATATTTTTAGG - Intergenic
1117608547 14:57458113-57458135 TTACCTCACATCATTTTTTGTGG - Intergenic
1118805119 14:69229363-69229385 TTTTCCCATATGATATTTTTGGG + Intronic
1119179289 14:72594066-72594088 TAAGCCCACACTATCTTTTGGGG - Intergenic
1123693117 15:22855778-22855800 TCTGCCCATATGATATTTGGGGG + Intronic
1123861593 15:24473618-24473640 TTAGCACAGATGATATTGTGGGG + Intergenic
1126665042 15:51068493-51068515 TTAGCCCACTAGAGATCTTGAGG + Intronic
1126840847 15:52715976-52715998 TGAGGCCAGAGGATATTTTGAGG + Intergenic
1127605856 15:60587791-60587813 TTAGCCCTCATCATATTTTCAGG - Intronic
1132063967 15:98715244-98715266 TTAGCCCACCTCATTTCTTGGGG + Intronic
1133507570 16:6427047-6427069 TTAGCCCTGCTGATATTATGAGG + Intronic
1139369949 16:66460773-66460795 TTAGCCAATATGCTATTCTGTGG - Intronic
1144813182 17:18014961-18014983 TTTTCCCACATGAGATTATGTGG + Intronic
1145295220 17:21585584-21585606 TTGTACAACATGATATTTTGAGG + Intergenic
1148524778 17:48321195-48321217 TTGGCCCAAATGATTTCTTGAGG - Intronic
1150599332 17:66636998-66637020 TTTGGCCACATGTAATTTTGGGG + Intronic
1155221983 18:23693701-23693723 TCAGCTCAAATAATATTTTGGGG + Intronic
1155487528 18:26361952-26361974 TTAGCATACATTTTATTTTGTGG + Intronic
1158384317 18:56972030-56972052 TTAGCTAAAATTATATTTTGGGG + Intronic
1159072010 18:63635125-63635147 TTACCTCACATAATTTTTTGTGG - Intergenic
1159073478 18:63653064-63653086 TTACCTCACATAATTTTTTGCGG - Intronic
1159393005 18:67819134-67819156 TTCCCCCACATAATATTTTGGGG - Intergenic
1161625712 19:5325416-5325438 ATGGCCCACATGAGATATTGTGG - Intronic
1164133455 19:22387432-22387454 TCATCTCACATGGTATTTTGTGG - Intergenic
1164165356 19:22669312-22669334 TCATCTCACATGGTATTTTGTGG + Intergenic
1164285080 19:23807285-23807307 TTTGACAAAATGATATTTTGGGG + Intronic
926692997 2:15750152-15750174 TTCGCCAACATTATATTTAGAGG + Intergenic
930888937 2:56360799-56360821 TTAGCCTATATGAGATTCTGGGG - Intronic
930926681 2:56826749-56826771 TTTGCCCCCATGTTATTTTAAGG + Intergenic
935220667 2:101009699-101009721 TAATCCCACAAGATGTTTTGTGG + Intronic
939284274 2:140108981-140109003 TTAGAGCACTTGATATTTTCAGG - Intergenic
943548142 2:189306965-189306987 TTGGGTCACATTATATTTTGAGG - Intergenic
943989879 2:194674590-194674612 CTAGCCCATTTAATATTTTGTGG - Intergenic
1170581927 20:17705778-17705800 TTACCCCAGATGCTATGTTGAGG + Intronic
1173070118 20:39755933-39755955 TTATACCACTTGTTATTTTGTGG - Intergenic
1173719676 20:45244497-45244519 TTAGCTCTAATAATATTTTGAGG + Intergenic
1174726910 20:52872178-52872200 TTAGGCCACCTGATACATTGGGG + Intergenic
1174802799 20:53579059-53579081 TTCGCCCACATGAGTGTTTGTGG - Intronic
1177035690 21:16039554-16039576 TTAACCCACATGATATTGTTTGG - Intergenic
1177165861 21:17603008-17603030 TCAGACCACATGACATTTTTTGG + Intronic
1177828690 21:26112412-26112434 TTTTCCCATATGAGATTTTGTGG + Intronic
1179028624 21:37701038-37701060 TTAGGACACATTATATTTTAGGG + Intronic
1181138006 22:20782789-20782811 TTGGGCCACATAATAGTTTGTGG - Intronic
1185407340 22:50660951-50660973 TTACCCCACATCATTTTTTATGG + Intergenic
949112931 3:284594-284616 TTATCACACAGGATATTTTAAGG - Intronic
950996435 3:17502522-17502544 TTGGCCTACATGCTATTATGAGG + Intronic
951847940 3:27104510-27104532 TTAGCCCAGATGTGTTTTTGTGG - Intergenic
952089145 3:29863582-29863604 TTAGCCACCCTGATATTTGGGGG - Intronic
952263455 3:31762823-31762845 TTTGCCCAAATCATAATTTGCGG + Intronic
953078052 3:39589177-39589199 TTAGCTCTAATAATATTTTGTGG - Intergenic
953721198 3:45356683-45356705 TCAGCGGACATGATATTTTGTGG + Intergenic
956306191 3:67829118-67829140 ATAGCACAGACGATATTTTGTGG - Intergenic
957805214 3:85139335-85139357 TTGTCTCAAATGATATTTTGGGG - Intronic
958948933 3:100396333-100396355 TTAGCCCACATGAAATGGTTAGG - Intronic
963963535 3:151338421-151338443 TTAGCCCCCAAGAGATTTTTGGG + Exonic
964036955 3:152210696-152210718 TTAGCCTAGATGTCATTTTGAGG + Intergenic
964502838 3:157367436-157367458 TTACCACACAAGAAATTTTGGGG + Intronic
964586420 3:158309943-158309965 TTAGCTACCATGATATTTTAAGG + Intronic
967247756 3:187505101-187505123 TTACCCTACAAGCTATTTTGGGG - Intergenic
969182298 4:5451643-5451665 TGAGGCCAGATGATTTTTTGTGG + Intronic
971563017 4:28105603-28105625 TAAGCACACATGAAATCTTGGGG + Intergenic
971928721 4:33049807-33049829 TAAGACCATATGAAATTTTGAGG + Intergenic
974692965 4:65324269-65324291 TTTGCCAACATGAAATATTGAGG - Intronic
978622424 4:110646573-110646595 GTGGACAACATGATATTTTGAGG - Intergenic
979055407 4:115986966-115986988 TTAGTCCACATAATGTTTAGGGG + Intergenic
980132023 4:128825742-128825764 TTAGCTAACATAATAATTTGAGG - Intronic
980249154 4:130291460-130291482 TTAGCACTCCTGACATTTTGAGG - Intergenic
980769946 4:137358115-137358137 TAAGACCACATGGTATTTGGCGG - Intergenic
981002223 4:139838997-139839019 TTAGCCCACCTGAATTTTTTAGG - Intronic
981461214 4:145015039-145015061 TGAGCCAATATGATTTTTTGGGG - Intronic
983026887 4:162749133-162749155 TTCCCTCACATGATCTTTTGGGG - Intergenic
983352219 4:166604372-166604394 TTATCCTACTTGATATTTTCTGG - Intergenic
985916800 5:2926675-2926697 GTAGCCCCCATGATAAGTTGAGG - Intergenic
989476155 5:41875552-41875574 TAAGGCCACATGATTTGTTGAGG - Intergenic
989712770 5:44420452-44420474 TTAGACCACATTCTATTTTAAGG + Intergenic
990683612 5:58274459-58274481 GTAGCTAACATGATATATTGGGG - Intergenic
992352988 5:75949898-75949920 ATAGCCCACAGGATTTCTTGAGG + Intergenic
993089461 5:83406942-83406964 TTTGACCAGATGATATTTTAGGG - Intergenic
996162818 5:120187047-120187069 TTTGACCTCATGATATCTTGGGG - Intergenic
997057044 5:130456602-130456624 TTAGCCCAGGTGACATTTTTGGG - Intergenic
997422544 5:133780572-133780594 TTAGCACAGAAGACATTTTGAGG + Intergenic
1008190390 6:48448986-48449008 TTAGCTCACCTTCTATTTTGAGG - Intergenic
1009202978 6:60768323-60768345 TTATCAGACAGGATATTTTGAGG + Intergenic
1010653431 6:78481658-78481680 TCAGCTCACAAGATATTTTTAGG - Intergenic
1017546723 6:155459806-155459828 AAAGCCCACATCATCTTTTGTGG - Intergenic
1020835069 7:13139003-13139025 TTATCACACATGATATTTTAAGG + Intergenic
1020870827 7:13627023-13627045 TTGGCTCACATGATATATGGAGG + Intergenic
1021621188 7:22552510-22552532 TTAGCACCCATGTTATTTTTGGG - Intronic
1023576085 7:41628502-41628524 ATAGCACTCTTGATATTTTGAGG - Intergenic
1032629440 7:133632374-133632396 TCAGACCACATAATATTTTGGGG - Intronic
1034039480 7:147862049-147862071 TTAGCCAATATGGTATTTTGTGG + Intronic
1037064067 8:14553986-14554008 TTAGCTCACTTTATATTTTCTGG - Intronic
1042771188 8:72384506-72384528 ATAGCCCACGGGATATTCTGTGG + Intergenic
1043784254 8:84377308-84377330 TTAGCCCACATGATATTTTGAGG - Intronic
1044964396 8:97561095-97561117 TCCGCCCACATGATTTTTGGGGG - Intergenic
1045308645 8:100981327-100981349 TGAGGTCACATAATATTTTGTGG - Intergenic
1046123019 8:109868397-109868419 TAAGCTCATATTATATTTTGGGG + Intergenic
1046548420 8:115681206-115681228 TTAGCCCATAAGATCTTTTGAGG - Intronic
1049958841 9:718907-718929 TAAGCCCAAATGATGGTTTGGGG - Intronic
1050816271 9:9816712-9816734 TTAGCCACAGTGATATTTTGGGG - Intronic
1055376556 9:75654844-75654866 TAAACCCACAAGATGTTTTGTGG - Intergenic
1058317933 9:103592390-103592412 TTAGCTCACATAGTATTTTTTGG - Intergenic
1058371173 9:104269530-104269552 TTAGCTCACAGGATATTTGGAGG - Intergenic
1060090644 9:120739809-120739831 TTTGCACCCACGATATTTTGGGG - Intergenic
1060900225 9:127250525-127250547 TAGGGGCACATGATATTTTGGGG + Intronic
1203446237 Un_GL000219v1:59003-59025 TTAGCTAACATGATCTTTTTGGG - Intergenic
1186390600 X:9154838-9154860 TTAGCGGACATGATATGTAGAGG + Intronic
1186855232 X:13619953-13619975 GCAGCACACAAGATATTTTGAGG + Intronic
1188290206 X:28378404-28378426 TTTGACCACAGAATATTTTGGGG + Intergenic
1189460486 X:41238784-41238806 TTAGGGCACATGGTATGTTGAGG + Intergenic
1189530503 X:41876883-41876905 TTTGCCTACAAGATATTTAGTGG - Intronic
1191971438 X:66821235-66821257 TTACTCCACATGAATTTTTGTGG + Intergenic
1193386660 X:80880862-80880884 TTGGCCCACATGACATTTCTTGG + Intergenic
1196391561 X:115212238-115212260 GTTGCCCCCATGAGATTTTGGGG - Intronic
1197065427 X:122227932-122227954 TTGGCCCACATGATATCCTAAGG - Intergenic