ID: 1043785550

View in Genome Browser
Species Human (GRCh38)
Location 8:84394101-84394123
Sequence CTGTAGAAACAGTGGAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 273}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043785550 Original CRISPR CTGTAGAAACAGTGGAAGAC TGG (reversed) Intronic
900008237 1:79684-79706 CTGTAGAGGCAGTGGCAGAGGGG - Intergenic
900666016 1:3816004-3816026 ATGTAGAAAGAGCGGAGGACGGG + Intronic
901233043 1:7651860-7651882 ATTTAGAAACAGTGGGAGACCGG - Intronic
904899869 1:33848412-33848434 CAGGAGAATCAGTGGGAGACTGG - Intronic
906686720 1:47767709-47767731 CTGTAGAAACAGGGCAGGGCAGG + Intronic
907189692 1:52638233-52638255 CTGGAGAAAGAATGGTAGACAGG + Intronic
908045812 1:60167318-60167340 CTGGAGAAGGAGTTGAAGACAGG - Intergenic
911197746 1:95012830-95012852 CTGTTGAAACAATGAAAAACAGG + Intronic
912580323 1:110715166-110715188 CTGTAAAAACTCTGGATGACAGG + Intergenic
912670298 1:111619112-111619134 TTGCAGAAACAGTGAAAGGCCGG - Intronic
913221830 1:116666672-116666694 CTGTATAATCAGTGGATGAAAGG - Exonic
914522343 1:148428913-148428935 CTGTAGAAACAAAAGAGGACGGG + Intergenic
914740395 1:150460048-150460070 TTGTTGAAACAGTCGAGGACAGG + Exonic
916683663 1:167126179-167126201 CTGTACGAGCAGTGGAAGAAGGG + Exonic
917036893 1:170757886-170757908 ATTTGGAAACAGTGGAAAACTGG - Intergenic
917498121 1:175561132-175561154 CTGTAAAAATAGTGCCAGACAGG - Intronic
918067643 1:181112319-181112341 CTGAAGAAACAGAAGCAGACAGG - Intergenic
918538671 1:185603761-185603783 ATCTAGATGCAGTGGAAGACTGG - Intergenic
918960491 1:191270406-191270428 CTCTGGAAACATTGGAAGAATGG + Intergenic
919979307 1:202632465-202632487 CTCTATAACCAGTGGAAGAAAGG + Intronic
920319607 1:205109021-205109043 CTCTAGGAACAGAGGAAGGCAGG + Intronic
920448715 1:206040631-206040653 CTGTAGAAAAATTAGAAAACAGG + Intronic
921826598 1:219679086-219679108 ATGTAGAAACAGTGGGAACCCGG + Intergenic
923706184 1:236346654-236346676 CTGTACAAAGAGTGGAAAACAGG + Intergenic
924248553 1:242108355-242108377 CTGCAGAAAACGTGGAAGGCAGG - Intronic
924446563 1:244138197-244138219 GTGTAGAAAAAGTGGAGGAGAGG - Intergenic
1062995620 10:1863583-1863605 CTGAAGAGACAGAGGAAGACGGG - Intergenic
1064448851 10:15423356-15423378 CTGTAAAAACAGTGGGAGGGAGG + Intergenic
1064547348 10:16463985-16464007 CATCAAAAACAGTGGAAGACCGG - Intronic
1065048746 10:21768663-21768685 CTGTAGAGAGAGTGGAAGGTAGG - Intronic
1065175084 10:23068021-23068043 CTCCAGAGACAGTGGAACACCGG - Intergenic
1067047645 10:42993562-42993584 CTGTTAAAACAGTGTAAAACTGG + Intergenic
1068362216 10:55991868-55991890 CTAAAGAAACAGAGGAATACAGG - Intergenic
1070870589 10:79748281-79748303 CTGCAGAGACAGTGGCAGAGAGG - Intergenic
1071637507 10:87270493-87270515 CTGCAGAGACAGTGGCAGAGAGG - Intergenic
1071657738 10:87467458-87467480 CTGCAGAGACAGTGGCAGAGAGG + Intergenic
1073056242 10:100704562-100704584 CTATAGCAACAGTAGAAGACTGG + Intergenic
1074051833 10:109887462-109887484 CTGTAGAAACAGAGGTAGATGGG - Intronic
1075900870 10:126041936-126041958 CTGCAGAAACAGTGCAAGGAAGG - Intronic
1078640403 11:13090194-13090216 AAGTTGAAACAGTAGAAGACTGG - Intergenic
1079091007 11:17480288-17480310 CTGTAGAACCAGTGAAAGAGAGG + Intergenic
1079989732 11:27233940-27233962 CTGCTGTAACAGTGGAAGAGGGG + Intergenic
1080460938 11:32454398-32454420 CTGCAGATACAATGGAGGACAGG + Intergenic
1081266064 11:41023153-41023175 TTGTAGAACCAGTAAAAGACAGG - Intronic
1081949058 11:47027106-47027128 CAGTAGAAACAGGGAAATACAGG - Intronic
1081983613 11:47285619-47285641 CTGTAGAGAAAATGGAACACAGG - Intronic
1083399086 11:62411553-62411575 CTGCAGAAACAGGGAAAGCCAGG + Intronic
1084163638 11:67364906-67364928 CTGTAGAAACAGGACAGGACAGG + Exonic
1086569130 11:88262912-88262934 CTGTAGAGACAGTGGCAGAGAGG + Intergenic
1086890350 11:92250940-92250962 CTGTAGCAACATTGTAAGAGCGG - Intergenic
1090002422 11:122973717-122973739 CTGGAGCAACATTTGAAGACAGG - Intergenic
1090522667 11:127495874-127495896 CTGCAGAAACAATTGAAGACTGG - Intergenic
1090602462 11:128387298-128387320 CTGGAGAAGCAGTGGGTGACAGG - Intergenic
1090769799 11:129909767-129909789 CTGTGGAAACAGTAGCAGGCTGG - Intronic
1091523150 12:1268522-1268544 CTTTAGGAACAGAGGAAGAGGGG + Intronic
1096336218 12:50758663-50758685 CTGAAGAAACAGTGCAACATTGG - Intergenic
1097516028 12:60607765-60607787 TGGTAGTATCAGTGGAAGACAGG + Intergenic
1098128474 12:67323560-67323582 CTGCAGAAGCAGTGGCAGAGAGG - Intergenic
1100133440 12:91524189-91524211 CAGAAGAAAAAGTGGGAGACAGG + Intergenic
1101381153 12:104215247-104215269 CTGAAGTGACAGTGGAAGCCAGG + Intergenic
1103160314 12:118723689-118723711 CTGGAGAAACACTGGGAGCCAGG + Intergenic
1103165284 12:118765126-118765148 CTGTTACAACAGTGGCAGACTGG + Intergenic
1105049323 12:133034495-133034517 TCATAGAAACAGTGGAAGAGTGG - Intergenic
1105383959 13:19913100-19913122 CTGAAGTGTCAGTGGAAGACAGG + Intergenic
1106020131 13:25906432-25906454 CTGTGGAAACCCTTGAAGACTGG - Intronic
1108898834 13:55371812-55371834 CAATAGAAACACTGGAAGGCAGG + Intergenic
1108942827 13:55978320-55978342 ATGTAGAAACTATGGAAAACTGG + Intergenic
1110804156 13:79735793-79735815 CTGCAGCAACAGTGGAAGAAGGG + Intergenic
1113555728 13:111232433-111232455 CCGTAGAACCATTGGTAGACAGG + Intronic
1113823446 13:113231989-113232011 CAGTAGTAACAGTGGTAGGCGGG - Intronic
1114044289 14:18708530-18708552 GTGAAGAATCAGTGGAAGATGGG - Intergenic
1114048569 14:18898980-18899002 GTGAAGAATCAGTGGAAGATGGG - Intergenic
1114113942 14:19502666-19502688 GTGAAGAATCAGTGGAAGATGGG + Intergenic
1114115642 14:19620417-19620439 GTGAAGAATCAGTGGAAGATGGG + Intergenic
1114134570 14:19833542-19833564 CTATAGAGACAGTAAAAGACTGG - Intergenic
1114624273 14:24118546-24118568 CTGGAGAGTCAGTGGAAGCCTGG - Intronic
1116018099 14:39431354-39431376 CTTTATAAACAGTGGTGGACGGG - Intronic
1117471264 14:56047935-56047957 CACTAGAAACAGTGCAAGCCAGG + Intergenic
1118547946 14:66915374-66915396 ATGGAAAAGCAGTGGAAGACTGG - Intronic
1120039694 14:79738649-79738671 CAGGAGAAACACTTGAAGACGGG - Intronic
1120681840 14:87489410-87489432 CTGTAGAAAAGGAGGAAGAAAGG + Intergenic
1120817548 14:88879347-88879369 CTTTAGCCACAGTGGAAAACTGG - Intronic
1121302617 14:92883937-92883959 CTGTGGAGACACTTGAAGACAGG - Intergenic
1123577622 15:21689112-21689134 CTATAGAGACAGTAAAAGACTGG - Intergenic
1123614246 15:22131593-22131615 CTATAGAGACAGTAAAAGACTGG - Intergenic
1124081647 15:26504276-26504298 CTGTCAAAACAGTGGAAGGCAGG - Intergenic
1124494905 15:30180421-30180443 CTCTATAACCAGTGGAAGAAAGG + Intergenic
1124748662 15:32358224-32358246 CTCTATAACCAGTGGAAGAAAGG - Intergenic
1128609391 15:69061806-69061828 CTGGAGAAACAAAGAAAGACAGG + Intronic
1129550732 15:76445987-76446009 TTGTAGAAATAGTGGTAGAAGGG + Intronic
1131180891 15:90239106-90239128 CTATATAAACAGTTGAAGATTGG + Intronic
1131678417 15:94695799-94695821 CTGCAGAGAAAATGGAAGACTGG + Intergenic
1132445318 15:101912426-101912448 CTGTAGAGGCAGTGGCAGAGGGG + Intergenic
1202986491 15_KI270727v1_random:423357-423379 CTATAGAGACAGTAAAAGACTGG - Intergenic
1134513739 16:14870069-14870091 GAGTAGAGACAGTGGCAGACAGG - Intronic
1134701379 16:16268565-16268587 GAGTAGAGACAGTGGCAGACAGG - Intronic
1134970451 16:18526081-18526103 GAGTAGAGACAGTGGCAGACAGG + Intronic
1138834099 16:60412335-60412357 CTATAAAAAGAGTTGAAGACGGG - Intergenic
1138894535 16:61187666-61187688 CTCTAGAAACTGAGAAAGACAGG - Intergenic
1142439550 16:90086916-90086938 CTGTAAAAACAGTCGGTGACTGG - Intronic
1143852237 17:9821728-9821750 CTGTAGATTCTGGGGAAGACAGG - Intronic
1143916930 17:10301177-10301199 CTGTAGCAACAGGGACAGACAGG + Intronic
1146223489 17:31046963-31046985 CTGGAGAAAAAGTAAAAGACTGG + Intergenic
1146270205 17:31480138-31480160 GTGGAGAAACAGTGGAACTCAGG - Intronic
1146341497 17:32023005-32023027 CTGGAGAAAAAGTAAAAGACTGG - Intronic
1146551798 17:33786728-33786750 CTGTAGAGGCAGTGAAAGTCAGG + Intronic
1146574797 17:33981584-33981606 CTTTAGAAACTGTGCAAGAGAGG - Intronic
1148389627 17:47262044-47262066 CTGTAGAAACACTTGAACAAAGG - Intronic
1148596778 17:48862753-48862775 CTGAGGATACAGTGGAAGACAGG + Intronic
1152850233 17:82629573-82629595 TAGGAAAAACAGTGGAAGACAGG - Intronic
1153583517 18:6598825-6598847 CTGGAGAGACAGCGGAAGGCAGG - Intergenic
1154098380 18:11442832-11442854 CAACAGAAACAATGGAAGACAGG - Intergenic
1154181651 18:12144151-12144173 CTGTAGAGGCAGTGGCAGAGAGG + Intergenic
1154182253 18:12147433-12147455 CTGTAGAGGCAGTGGCAGAGAGG - Intergenic
1155708559 18:28847248-28847270 CTGCAGTTACAGTGGAAGAGAGG - Intergenic
1156783314 18:40878619-40878641 CTGCATAAACAGGTGAAGACAGG + Intergenic
1158077363 18:53546150-53546172 CTGAAGATGCAGTTGAAGACAGG + Intergenic
1159320257 18:66838892-66838914 CTGTAGAGACTGTGGAAAAGTGG + Intergenic
1159832240 18:73291257-73291279 CTGAAGGACCAGTGGAAGAGTGG + Intergenic
1160639991 19:121281-121303 CTGTAGAGGCAGTGGCAGAGGGG - Intergenic
1162579511 19:11520059-11520081 CTATAGAGACAGTGGATGAGTGG - Intronic
1162760346 19:12885250-12885272 CTGTAGTTACAGGGGAAGAAGGG - Intronic
1164888020 19:31799786-31799808 CTGAAGAAACAGTGGAGCCCAGG + Intergenic
1167430604 19:49452150-49452172 TTGTGGAAAGAGTGGAAGTCTGG - Intronic
925036677 2:692457-692479 CTGTGGAAACAGAGAAAGACCGG + Intergenic
926188510 2:10709751-10709773 CAGTAGAAACAGGGGAGCACTGG - Intergenic
929094412 2:38249890-38249912 GTGTAAAAGCAGTGGATGACTGG - Intergenic
929904872 2:46036904-46036926 TTGTAAAACCAGTGGAAGCCTGG + Intronic
931345800 2:61445000-61445022 CTGTATAAACAATGGAAGCCAGG + Intronic
931543390 2:63354035-63354057 CTGTAGAGGCAGTGGCAGAGAGG - Intronic
932086140 2:68764056-68764078 CTGTAGAGACAGTGGTTGCCAGG - Intronic
932504948 2:72219907-72219929 ATGGAGACACAGTTGAAGACGGG + Intronic
933101839 2:78269907-78269929 CTGTATAAAAACTAGAAGACTGG - Intergenic
933373287 2:81445273-81445295 CTTTCCAAACAGTGGAAGGCAGG - Intergenic
934623213 2:95829035-95829057 CTGCAGAAGCAGTGGCAGAGAGG + Intergenic
934810553 2:97273058-97273080 CTGCAGAAGCAGTGGCAGAGAGG - Intergenic
934827139 2:97434881-97434903 CTGCAGAAGCAGTGGCAGAGAGG + Intergenic
938425936 2:131187487-131187509 GTGAAGAATCAGTGGAAGATGGG - Intronic
939620298 2:144410684-144410706 CTGTGTTCACAGTGGAAGACAGG + Intronic
940846584 2:158649187-158649209 CTGTAATAACAGGGGTAGACAGG - Intronic
943833946 2:192495431-192495453 CTTCAGAAACAAAGGAAGACAGG - Intergenic
944562782 2:200957691-200957713 CTATATAAACTGTGGAAGAGTGG - Intronic
948028451 2:234797504-234797526 ATGTAGAAAGACTGGAAGACTGG + Intergenic
948356307 2:237380587-237380609 CAGTAGAAACAGAAGAACACAGG + Intronic
1169933077 20:10854715-10854737 CTGGAGAAAAAGTGTGAGACAGG - Intergenic
1170013328 20:11752138-11752160 CTGCAGCAACAGGGGAAGACAGG - Intergenic
1173466690 20:43288528-43288550 ATGTAGAATCAGTGGGAGCCTGG + Intergenic
1173980909 20:47223411-47223433 CAGGAGAATCAGTGGAAGCCAGG + Intronic
1176726689 21:10441474-10441496 CATTAGAAACCATGGAAGACAGG - Intergenic
1177936459 21:27352392-27352414 CTCTACAATCAGTGGAACACTGG + Intergenic
1179054932 21:37922513-37922535 CCATAGAAACAGTGGAGCACAGG + Intergenic
1180287700 22:10765610-10765632 CATTAGAAACCATGGAAGACAGG + Intergenic
1180467107 22:15621641-15621663 GTGAAGAATCAGTGGAAGATGGG - Intergenic
1180693124 22:17734506-17734528 CTTTAGAAACAGTGCAACACTGG - Exonic
1183580122 22:38719755-38719777 TTGTAAAAACAGTAGGAGACAGG - Intronic
1184022483 22:41830260-41830282 CAGTAGAAATGGTGGAAGAAGGG - Intergenic
1185161419 22:49232200-49232222 CTGCAGAAACAGTGGATGTCAGG - Intergenic
1185305492 22:50113112-50113134 CTGTAGCATCAGTAGAAGAAGGG + Intronic
949564298 3:5230712-5230734 ATGTAGAATCAGTGGGAGCCCGG - Intergenic
949698419 3:6726893-6726915 CTGTAGAAATAGTGGTTGACAGG + Intergenic
950601005 3:14035470-14035492 CTGCAGAAGCAGTGGCAGAAAGG + Intronic
950809833 3:15640854-15640876 CTGTAGAAAATTTGGAAAACGGG - Intronic
951088202 3:18539559-18539581 CTGTAGTAACACTGGAAGAAGGG - Intergenic
953463049 3:43096819-43096841 CTTTAGAAACTGAGGCAGACAGG + Intronic
954089692 3:48274376-48274398 CTGTAGAACCAGTGAGAGAAGGG + Intronic
954463709 3:50642230-50642252 CTGCAGAAACAGAGGAGGAGGGG - Intronic
954498663 3:50988933-50988955 CTGCAGAAACAGTGCCAGAGAGG - Intronic
954820901 3:53326741-53326763 ATGTAGAATCAGTGGGAGCCTGG - Intronic
955375693 3:58394771-58394793 CTGTAGGAACAAAGGAAAACAGG - Intronic
958436292 3:94099887-94099909 CTGAGGAAAGATTGGAAGACAGG - Intronic
958852481 3:99345728-99345750 CTGCAGACACAGTGTAAGGCAGG - Intergenic
959174946 3:102896265-102896287 CTGGAGCACAAGTGGAAGACTGG - Intergenic
959405504 3:105958031-105958053 TTGTGGAAACAGTGGAATAACGG + Intergenic
959980017 3:112505502-112505524 CTATAGAAACAGTGGTTGCCAGG - Intergenic
961084213 3:124052650-124052672 CTCTAGAAAATGTGGAAGAAAGG - Intergenic
961772433 3:129259859-129259881 CTGTAGACACAGTAGGAGAGAGG + Intronic
965849195 3:173001959-173001981 ATGTAGAAAGAATGGAAGAATGG - Intronic
966126623 3:176584784-176584806 CTGAAGCAACAGAGGAAGAATGG + Intergenic
967822310 3:193849539-193849561 CCATAGACACAGTGGAAGAGGGG - Intergenic
968234902 3:197025815-197025837 GGGTAGACACAGGGGAAGACTGG + Intronic
970591565 4:17564573-17564595 CAGTAGCAGCAGTGAAAGACCGG + Intergenic
970591657 4:17565331-17565353 CAGTAGCAGCAGTGAAAGACTGG + Intergenic
971036274 4:22696231-22696253 CTGTAGATGCATTGGAAGTCAGG + Intergenic
971255542 4:25010385-25010407 CTGAATAAACAGTGGGTGACTGG + Intronic
971954867 4:33403557-33403579 CTGGAGAAAGAGAGGAAGAAAGG - Intergenic
972910008 4:43803321-43803343 CTGTAGAACAAGTTGAAGGCAGG - Intergenic
974688079 4:65257595-65257617 CTGCATAAACAGGGGAAGAAGGG + Intergenic
975109575 4:70608594-70608616 CAGCAGCAACAGTGGAAGAATGG + Intergenic
975389814 4:73802897-73802919 CTGTAGCAGCAGTGGAAAAGGGG - Intergenic
975533435 4:75424331-75424353 CTTAAGAAACAGAGGAAGGCAGG - Intergenic
976520868 4:86024570-86024592 CAGTAGACATTGTGGAAGACAGG - Intronic
976627884 4:87206590-87206612 CTGTAGAAATGGTGGGAGATGGG + Intronic
977623754 4:99166914-99166936 CTTTAGTAAAAATGGAAGACTGG - Intergenic
978208243 4:106105063-106105085 CTGCAGAGACAGTGGCAGAGAGG - Intronic
979277948 4:118834737-118834759 TTGTAGAATCAGTGGAAATCTGG - Intronic
979297254 4:119047762-119047784 CAGTAGAAACAGTTCAACACTGG - Intronic
979631278 4:122905730-122905752 TTGAAGAAACTGTGGAAGCCAGG - Intronic
980952911 4:139399418-139399440 ATGTAAAAACAGTGGCAGATGGG - Intronic
982015943 4:151153784-151153806 CTTTATAAACAGTGCAGGACAGG + Intronic
982342359 4:154314252-154314274 CTGTAGAAACAGAGCAATACAGG - Intronic
982646211 4:158027422-158027444 CTGCAGAGACAGTGGCAGAGAGG - Intergenic
982864449 4:160492630-160492652 CTTTAGTAAAAATGGAAGACTGG + Intergenic
984133674 4:175909952-175909974 CTGTAGTGACAGTGGAAAATAGG - Intronic
987109565 5:14672529-14672551 CTGCAGACCCAGTGGAACACAGG - Intronic
987464611 5:18256927-18256949 CTGTAGAAACAGAGATAGAGAGG + Intergenic
988569190 5:32347265-32347287 CTTTAGTAAAAATGGAAGACTGG + Intergenic
989461818 5:41708498-41708520 CTGCAGCAACAGTGGCAGAGAGG - Intergenic
990059779 5:51633168-51633190 CTTTAAAAACAGAGAAAGACTGG - Intergenic
990119034 5:52425975-52425997 CTGTAGTAACAGTTGAACAGCGG - Intergenic
991146080 5:63306068-63306090 CTGTAAAAACAGGTGTAGACAGG + Intergenic
991998864 5:72416464-72416486 CTGTAGAAACTGGGGAACTCAGG - Intergenic
993018681 5:82564631-82564653 CTGCAGATACAGTGGCAGAGAGG - Intergenic
993497757 5:88627083-88627105 CTGTTTTAACAGTGGGAGACTGG + Intergenic
995908186 5:117152278-117152300 TGGTAGAAAAAGTGGAACACTGG - Intergenic
995979577 5:118085281-118085303 TTGCAGAAACAATTGAAGACAGG + Intergenic
996863075 5:128086780-128086802 CTGTCGAAAGAGGGGCAGACAGG + Intronic
997640293 5:135444552-135444574 CAGTAGATACAGTGGAAGACAGG + Exonic
999052172 5:148534544-148534566 CTGCAGAAGCAGTGGCAGAGAGG - Intronic
999420954 5:151442666-151442688 CTGTACAAACAGTAGAACAGAGG - Intronic
999523132 5:152373272-152373294 TTAAAGAAACAGTGGAAGACAGG - Intergenic
999873427 5:155775769-155775791 CTTGGGAAACAGTGGTAGACAGG + Intergenic
1002440253 5:179260638-179260660 CTGTAGAAACAGTGGGAGCCAGG - Intronic
1002747341 6:69688-69710 CTGTAGAGGCAGTGGCAGAGGGG - Intergenic
1004113356 6:12743283-12743305 CTTTAGCAAAAGTGGGAGACTGG - Intronic
1004185151 6:13415234-13415256 TTCTGGAAAGAGTGGAAGACGGG - Intronic
1004327268 6:14686698-14686720 CTGTAAAAACAGATGAAGCCTGG + Intergenic
1006288470 6:33116227-33116249 CTGTAGAAAGAAAGGAAGAAAGG + Intergenic
1006370900 6:33643093-33643115 CAGTGGAAACAGTGAAAGCCAGG - Intronic
1006829049 6:36957945-36957967 CTCTGGCAACAGTGGGAGACTGG - Intronic
1007928204 6:45667314-45667336 CTGGAGGAACAGTGGCAGTCAGG + Intergenic
1008946019 6:57097789-57097811 CTGAAGTAACAGTGGTACACAGG - Intronic
1009769553 6:68127247-68127269 CTGCAGAGACAGTGGCAGAGAGG + Intergenic
1012697172 6:102401148-102401170 CTATAGAAAAAGTGGAAAAGTGG - Intergenic
1013007986 6:106092268-106092290 CTGTGGAAACTGTGGACGGCGGG + Intronic
1014191082 6:118497436-118497458 ATGTAGAATCAGTGGGAGCCCGG - Intronic
1014911570 6:127100356-127100378 CTGTAGAAATCTTGGAAGTCTGG - Intergenic
1014983325 6:127972056-127972078 CTGTAGAAAGGGTGGAAGTCTGG + Intronic
1016107620 6:140181997-140182019 ATATAGAAACAGTGAAAGATTGG - Intergenic
1017658487 6:156651946-156651968 CTGGAGAAACACTTGAACACAGG + Intergenic
1018648053 6:165966186-165966208 CTGCAGAAAGAGTGGAAAAGTGG + Intronic
1022748164 7:33193996-33194018 GAGTAGAAGAAGTGGAAGACAGG - Intronic
1024512195 7:50212990-50213012 CTGGAGAAAGAGTGGGAGGCAGG + Intergenic
1025097776 7:56110505-56110527 CTGTAGAAAAACTGGAAAATAGG - Intergenic
1025282464 7:57638263-57638285 CTGGTGAAACAGTGGAAAGCAGG - Intergenic
1025822247 7:64977344-64977366 ATGTAGAAAGGGTTGAAGACTGG + Exonic
1025991479 7:66500588-66500610 CTGTAGAAAAATTGGAAAATAGG + Intergenic
1027213744 7:76170446-76170468 CTGTAGAAAAATTGGAAAATAGG + Intergenic
1028334938 7:89640219-89640241 ATGGAGAAACAGTGGAAAAAGGG - Intergenic
1028456460 7:91043229-91043251 TTGTAGAAACAGAGGCAGCCAGG + Intronic
1028779649 7:94721342-94721364 CTGTATAAACAGTGAAAGTAAGG + Intergenic
1029598123 7:101548494-101548516 CTGGAGAAGCAGTGGAAAGCTGG + Intronic
1029612535 7:101634886-101634908 CTGTAGAATCAATGGCTGACAGG + Intergenic
1030809396 7:113956214-113956236 CTGCAGAGACAGTGGCAGAGAGG + Intronic
1031693525 7:124819201-124819223 CTTTAGAAACAGGGCAAGAAGGG - Intergenic
1031801635 7:126253801-126253823 CTGTGGTAGCAGTGGCAGACTGG - Intergenic
1032814890 7:135463239-135463261 CTATAAAAACCCTGGAAGACCGG + Intronic
1033516278 7:142109980-142110002 CTGCAGAAACAGGGGGAGATGGG + Intergenic
1034603422 7:152286482-152286504 CATTAGAAACCATGGAAGACAGG + Intronic
1037567284 8:20128521-20128543 CTGCAGAAACAGTGTAAGCTGGG + Intergenic
1038863605 8:31414613-31414635 ATGTAGAATCAGTGGGAGTCTGG + Intergenic
1039222424 8:35348146-35348168 CAATAGAAAAAGTGGAAGAGTGG - Intronic
1039622304 8:39009527-39009549 CTGTAGAAAAGGAGGAAAACAGG - Intronic
1040805858 8:51395685-51395707 CTGAAAAAGCAGTAGAAGACTGG + Intronic
1041569719 8:59323769-59323791 CTGTAGAAAAAGAGATAGACTGG - Intergenic
1041952888 8:63524293-63524315 CTGCAAAACCAGTGGAAGGCAGG + Intergenic
1042863040 8:73332977-73332999 CTGGAGAAACCATGGAAGCCAGG - Intergenic
1043235726 8:77863394-77863416 CTGTAGAAAAATTTGAAGTCAGG - Intergenic
1043235727 8:77863422-77863444 CTGTAGAAAAATTTGAAGTCAGG - Intergenic
1043235728 8:77863450-77863472 CTGTAGAAAAATTTGAAGTCAGG - Intergenic
1043502145 8:80868941-80868963 TTGTAGAGAAAGTGGAGGACTGG - Intronic
1043612805 8:82086657-82086679 CTGCAAAAACAGTAGAAGTCTGG + Intergenic
1043785550 8:84394101-84394123 CTGTAGAAACAGTGGAAGACTGG - Intronic
1044204801 8:89480587-89480609 TTGTGGAAACACTGGAGGACAGG + Intergenic
1044755974 8:95461595-95461617 CTGTAGAAAGGCTGGAAGAGAGG + Intergenic
1045989269 8:108286568-108286590 GTGAAGAAAGAATGGAAGACAGG + Intronic
1046035781 8:108839771-108839793 CTGTAGTCACACTGGAAAACTGG - Intergenic
1048589757 8:135810500-135810522 ATGTAGAACCAGTTGCAGACAGG + Intergenic
1050876174 9:10639731-10639753 CTATAGAACAAGTGGAAGACTGG - Intergenic
1051187247 9:14473177-14473199 CTGCAGAAACACTGAAGGACAGG + Intergenic
1051822249 9:21181591-21181613 CTGCAGAGGCAGTGGTAGACAGG - Intergenic
1051827281 9:21234247-21234269 CTGCAGAGGCAGTGGTAGACAGG - Intronic
1052789455 9:32861236-32861258 CTGAAGAAAAAGTAGAAGACTGG - Intergenic
1053070335 9:35097379-35097401 CTGGAGAATCAGTTGAAGTCAGG + Intergenic
1055105839 9:72512066-72512088 CTATTGTAACATTGGAAGACTGG + Intergenic
1055208683 9:73763149-73763171 CTGCAGAGGCAGTGGCAGACAGG - Intergenic
1055778232 9:79790070-79790092 CTGTGGAAACAGTAGGAGAGGGG - Intergenic
1056127865 9:83554687-83554709 CTGCAGAAGCAGTGGAAGAGAGG + Intergenic
1056247019 9:84705717-84705739 CCTTAGAAACTGTGGAAGATAGG + Intronic
1059393099 9:114011941-114011963 CTGTTGAAACAGAGTAAGTCTGG + Intronic
1061010112 9:127949774-127949796 GTGTGGAAACAGAGGAAGAGAGG + Intronic
1061400829 9:130367450-130367472 CTCTAGAAACAGAGGAGGAAGGG + Intronic
1185985351 X:4826658-4826680 ATGTAGAATCAGTGGGAGCCTGG + Intergenic
1187580869 X:20605936-20605958 CTAAAGAACCAGGGGAAGACTGG - Intergenic
1188401461 X:29750273-29750295 CTGAAGAAAAAGTGGAAAACAGG - Intronic
1188715013 X:33449618-33449640 CTGTAGAGGCAGTGGCAGAGAGG - Intergenic
1193186463 X:78519467-78519489 CTCTAGAAACAGTTTAAGAAGGG - Intergenic
1194917528 X:99723408-99723430 CTGCAGAGACAGTGGCAGAGAGG - Intergenic
1195541837 X:106070875-106070897 GTGAAGAAATAGTTGAAGACAGG - Intergenic
1195856505 X:109338199-109338221 CTGCAGAGACAGTGGCAGAGGGG + Intergenic
1198850111 X:140957222-140957244 CTGTAGCAACAGAGCAAGACTGG + Intergenic
1200925165 Y:8647730-8647752 CTGAAGGAACAGTGGTATACTGG + Intergenic
1201238394 Y:11933840-11933862 CTGGAGAAACATGGGAAGAGTGG + Intergenic
1201577485 Y:15476794-15476816 ATGTAGAATCAGTGGGAGCCCGG + Intergenic