ID: 1043796672

View in Genome Browser
Species Human (GRCh38)
Location 8:84550234-84550256
Sequence AAGGAAAAGGAGAAAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2714
Summary {0: 1, 1: 1, 2: 21, 3: 326, 4: 2365}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043796672_1043796677 25 Left 1043796672 8:84550234-84550256 CCCTCCACTTTCTCCTTTTCCTT 0: 1
1: 1
2: 21
3: 326
4: 2365
Right 1043796677 8:84550282-84550304 ACAAGCTATAAAAACTAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043796672 Original CRISPR AAGGAAAAGGAGAAAGTGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr