ID: 1043798441

View in Genome Browser
Species Human (GRCh38)
Location 8:84576938-84576960
Sequence CTGTAAACTAACATGAAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043798441 Original CRISPR CTGTAAACTAACATGAAGGT TGG (reversed) Intronic
908306257 1:62821287-62821309 CTGTAAATGATTATGAAGGTAGG + Intronic
911006895 1:93235403-93235425 GTGTCAAGTAAAATGAAGGTTGG + Intronic
915330449 1:155108635-155108657 CTGAGCTCTAACATGAAGGTGGG - Intergenic
915891086 1:159774508-159774530 CTGGAAACTAACGTAAAGGTAGG + Intergenic
917997805 1:180459589-180459611 TTATAAACTAAAATGAATGTGGG - Intronic
921349686 1:214222892-214222914 CTAGAAAGTAACATGAAGGAAGG + Intergenic
923359053 1:233189627-233189649 CTGTAAAGTAGCATGATGTTAGG + Intronic
1063031572 10:2240466-2240488 CAGTGAACTAACTTGCAGGTAGG + Intergenic
1064583119 10:16814141-16814163 CAGTAAAGAAACATGGAGGTTGG + Intronic
1064676417 10:17764807-17764829 CTGAAAACAGACATGCAGGTGGG - Intronic
1068567430 10:58591458-58591480 CTGTAACCTCACATGATGGAAGG + Intronic
1070512786 10:77176550-77176572 CTGTAAAATAACATGAAGCATGG + Intronic
1073422060 10:103432567-103432589 CTGTAAAACAACATGAAATTGGG + Intronic
1074514852 10:114157154-114157176 CTGAAAACTTGCATGTAGGTTGG - Intronic
1076480141 10:130779514-130779536 CTGTAAACCCACCCGAAGGTGGG - Intergenic
1079091589 11:17484348-17484370 CTGTAAACTTACATGGTGGAAGG - Intergenic
1079392000 11:20030070-20030092 CTGGAAACTAACAGGAATATGGG - Intronic
1079643215 11:22831782-22831804 CAGTAAACTACCATGAAGACGGG - Intergenic
1080463055 11:32472470-32472492 CTTTAAATTAACAGGAAAGTGGG + Intergenic
1081564054 11:44245674-44245696 CTGTTGAGTGACATGAAGGTGGG + Intergenic
1083542016 11:63518102-63518124 CTGTAATCTCACATGGTGGTAGG - Intergenic
1085897392 11:80656160-80656182 CTGTTACATAACATGAAGTTTGG - Intergenic
1085995809 11:81912268-81912290 CTGTATAATAATAAGAAGGTAGG - Intergenic
1090766256 11:129878822-129878844 CTATAAACTCCCATGAGGGTGGG - Intronic
1095946828 12:47758546-47758568 TTGAAAAGAAACATGAAGGTGGG - Exonic
1102848295 12:116211908-116211930 CTGTAAAGCAACATGAGAGTAGG + Intronic
1104379857 12:128297972-128297994 AGGGAAACTAACATGAAGGAGGG - Intronic
1105056489 12:133104808-133104830 CTTTAACCTAAAATGAAAGTTGG - Intronic
1106526290 13:30543791-30543813 CTGTAAACTCTCAATAAGGTAGG - Intronic
1106668227 13:31875709-31875731 CTGTAAGCTAACATGAGCCTAGG - Intergenic
1107572023 13:41671742-41671764 CTGTATCCTAACATGAATGGGGG - Intronic
1109514739 13:63427507-63427529 CTATAAACAGACATGCAGGTAGG - Intergenic
1110012241 13:70351451-70351473 CTGTAGAATAATATGAAGTTTGG + Intergenic
1112287394 13:98116421-98116443 CCGTAATCCAACATGACGGTCGG + Intergenic
1115001085 14:28420539-28420561 CAGTAAACTATCATGAAGGCAGG + Intergenic
1115292917 14:31793241-31793263 CTGGAAAGTAAAAGGAAGGTGGG - Intronic
1117098636 14:52322788-52322810 CTATAAACTGACATGCATGTAGG - Intronic
1117419359 14:55528889-55528911 CTGAAAAATCACATGAAGATTGG - Intergenic
1118046260 14:61974625-61974647 CTGTAAGGGAACATGAAGGTGGG + Intergenic
1119327222 14:73767717-73767739 CTGGAAACTCCCATGAAAGTAGG + Intronic
1119367088 14:74102063-74102085 TTGTAAACTAAAATGCTGGTTGG - Intronic
1119433769 14:74584896-74584918 CTGGAACCTAACCTCAAGGTCGG + Intronic
1122474946 14:102001047-102001069 CTGAAAGGTTACATGAAGGTAGG + Exonic
1124922913 15:34043889-34043911 CTCTATACTAACAGGAAGGAAGG - Intronic
1128350582 15:66885752-66885774 CTGTAACCTCAAATGAAGGAAGG + Intergenic
1136675339 16:31900337-31900359 TTGAAAAATAACATGATGGTAGG - Intronic
1137835745 16:51590712-51590734 CTGAGAACTAAGATGAAGATAGG - Intergenic
1140116105 16:72042939-72042961 GAGTAAAAGAACATGAAGGTGGG - Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1147034589 17:37670741-37670763 CTGTAAACTACCTTGAAGGGAGG - Intergenic
1147685513 17:42284601-42284623 GTGCACACTTACATGAAGGTGGG - Intergenic
1148398681 17:47333537-47333559 CTGTAAAGTTACAAGAAGATAGG - Intronic
1151603692 17:75122978-75123000 CTGTAATTTAAGATGAAGGAGGG - Intronic
1153751119 18:8231693-8231715 CTGTAAAGTAGAATAAAGGTAGG - Intronic
1157133090 18:45026475-45026497 CGGTAAAGTAAAATCAAGGTAGG - Intronic
1157788193 18:50505805-50505827 CTGTACACTAATATTTAGGTTGG - Intergenic
1158547732 18:58410313-58410335 CTGTAAACTCAGAGGAGGGTTGG - Intergenic
1159861011 18:73649152-73649174 GTGTAAAATAACACAAAGGTGGG - Intergenic
1162502405 19:11061401-11061423 CTGTAGAGAAACATGAAGTTTGG + Intronic
1165299200 19:34957549-34957571 GTGTAGAGTAACATGAAGGCTGG + Exonic
1167309208 19:48727192-48727214 TTGTAAACTATGATGAGGGTTGG - Intronic
1168296789 19:55380958-55380980 GCGTAAGCTAACATGAAGCTTGG - Intronic
927555625 2:24029428-24029450 CTGTTAACTAAGATCAATGTGGG - Exonic
930321180 2:49856680-49856702 CTGTAAGCCCAGATGAAGGTAGG + Intergenic
932910040 2:75796821-75796843 CTGTGAACAAAAATGAAGCTGGG + Intergenic
933161126 2:79026305-79026327 CTGCAAGTTAACATGAAGGAAGG - Intronic
935574453 2:104694406-104694428 GTGTGAAATGACATGAAGGTTGG - Intergenic
936895271 2:117420704-117420726 CAGTAAACAATCATTAAGGTTGG + Intergenic
1169374002 20:5051438-5051460 CTGGTATCTAACATGAATGTTGG + Intergenic
1172168399 20:32913308-32913330 CTGTAAACTTACATGGTGGAAGG + Intronic
1172827521 20:37803031-37803053 CTGAGAAGGAACATGAAGGTAGG + Exonic
1173810198 20:45950716-45950738 CTGTGCACTAACAAGAAGCTGGG + Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1179382839 21:40915320-40915342 CTGCAAACTCACATGGAGGGTGG - Intergenic
953009488 3:39011147-39011169 CTGTAAACCATCAGGGAGGTCGG - Intergenic
954342312 3:49964884-49964906 ATTTAAACTAAAATTAAGGTGGG - Intronic
960724011 3:120651957-120651979 CTTTCAACTAATATGAATGTAGG + Intronic
963203803 3:142612504-142612526 AACTAAAGTAACATGAAGGTAGG - Intronic
963574764 3:147046156-147046178 CTGTAAACAAATCTGAATGTGGG + Intergenic
967141987 3:186569212-186569234 TTGTAAACTAGCATGGAGTTGGG + Intronic
970932007 4:21523085-21523107 CTGTAACCTAACATGGTGGAAGG - Intronic
971832048 4:31707069-31707091 CTATAAACTGACCTGAAGCTGGG - Intergenic
972149419 4:36070169-36070191 ATGTAACCTTAAATGAAGGTGGG + Intronic
972155331 4:36154030-36154052 CTTTAACCTAACAGGCAGGTGGG + Intronic
973077904 4:45953564-45953586 CTCTAAGCTAACATGAATGTTGG + Intergenic
974592946 4:63978666-63978688 CTATTAAATAAAATGAAGGTGGG - Intergenic
976797629 4:88952467-88952489 CTGTCAAATAGCATGAAGCTGGG - Intronic
980791329 4:137623312-137623334 GTGTAAAATAAAATGGAGGTAGG - Intergenic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
983270788 4:165559211-165559233 TTGTTAAATAACAAGAAGGTAGG - Intergenic
983607081 4:169599764-169599786 TTGTGAACAAACATGAAGATGGG + Intronic
984072680 4:175135246-175135268 ATGTAGACTACCATGAAAGTAGG + Intergenic
984560603 4:181264485-181264507 CTATAAACCAACATTAAGATAGG + Intergenic
985071965 4:186174465-186174487 GTCTAAACTAACATTAAGGTAGG + Intergenic
986230850 5:5863755-5863777 CTGTAACCTCACATGATGGAGGG - Intergenic
988821230 5:34888129-34888151 CTGTAAACTCACATGGTGGAAGG - Intronic
990160120 5:52928717-52928739 CTGTAAAATAAAATGAATGGTGG + Intronic
991083792 5:62629578-62629600 CTGTGAAATTTCATGAAGGTGGG - Intergenic
1000950954 5:167482483-167482505 CTGTAAAAAAATCTGAAGGTTGG - Intronic
1002140143 5:177133244-177133266 CTGTAACCTAAGATGGAGGCCGG + Intronic
1002877952 6:1227605-1227627 CTTGAAACAAACATCAAGGTGGG + Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1008928109 6:56908828-56908850 CTGTAAACTGTCATGGCGGTGGG - Intronic
1009537144 6:64901907-64901929 CTATAAACTAACAGTAAGATTGG + Intronic
1010628307 6:78166581-78166603 CTGTAATCTCACATGAAAGAAGG + Intergenic
1011793784 6:90930071-90930093 GTGTAAACTAACATGAAGCTAGG + Intergenic
1020184334 7:5947411-5947433 CTGTAAAAACAGATGAAGGTAGG + Intronic
1020298583 7:6777355-6777377 CTGTAAAAACAGATGAAGGTAGG - Intronic
1020930542 7:14387710-14387732 CTCTAAACTTACATGAGGCTAGG - Intronic
1024529360 7:50378391-50378413 GTGGAAATTAACATGAAGGTAGG + Intronic
1024679354 7:51668419-51668441 CTTGAAACTAACTTGAAGATGGG + Intergenic
1027842748 7:83334764-83334786 ATGTAAACTAAATTTAAGGTTGG + Intergenic
1031610805 7:123824780-123824802 CTGTTAAATTACATGAAGGCAGG + Intergenic
1033943334 7:146682462-146682484 CTGTGAACTAACATGAAGTTTGG - Intronic
1034114557 7:148572228-148572250 CTGCAAAGTAAGATGAGGGTGGG + Intergenic
1034173978 7:149086198-149086220 CTGTAAAGGAACACCAAGGTGGG + Intronic
1036164986 8:6424284-6424306 CTGCAAACTAACAGCTAGGTGGG + Intronic
1039576808 8:38630243-38630265 CTTTAAAATAAAATGAAGGCTGG + Intergenic
1041376022 8:57209981-57210003 CTGGAAATGAGCATGAAGGTGGG + Intergenic
1041956893 8:63566149-63566171 CAGAAAACTAACAGGAAGTTGGG - Intergenic
1043105636 8:76106628-76106650 ATGTAGACTAACATAAAAGTTGG - Intergenic
1043798441 8:84576938-84576960 CTGTAAACTAACATGAAGGTTGG - Intronic
1045186569 8:99844321-99844343 CTGTAACCTCACATGATGGAAGG + Intronic
1045481934 8:102599927-102599949 CTTATCACTAACATGAAGGTGGG + Intergenic
1046757054 8:117982833-117982855 ATCTAAACTAACATTAATGTAGG - Intronic
1048718418 8:137295307-137295329 CTGTCAACTAAGATGAGGATTGG - Intergenic
1048914267 8:139166450-139166472 ATGCACACTAACATGCAGGTAGG + Intergenic
1050613090 9:7373359-7373381 CTGTAACCTCACATGTAGGAAGG - Intergenic
1050889003 9:10799322-10799344 CTGTAACCTAACATGACTGATGG + Intergenic
1052446161 9:28564443-28564465 CTGTAATCTAAGATAGAGGTAGG - Intronic
1060306246 9:122414953-122414975 CTTGAACCTAAAATGAAGGTAGG - Intergenic
1185725384 X:2416647-2416669 CTGTCATCTAAGATGAAAGTGGG - Intronic
1186081946 X:5942847-5942869 CTATAAACTAATCTTAAGGTTGG - Intronic
1187630927 X:21170961-21170983 TTGTCAAGTAACATGAAGTTGGG - Intergenic
1189561732 X:42197848-42197870 ATGTAAACTTACATGAATATAGG - Intergenic
1194852911 X:98891175-98891197 TTGCAAAATAACATGAAAGTTGG + Intergenic
1196079526 X:111616365-111616387 CTGGAAAATATTATGAAGGTCGG - Intergenic
1197645232 X:129010098-129010120 CTGTAAACAAGAATAAAGGTGGG - Intergenic
1198028155 X:132729201-132729223 CAGTAACCTAAGATTAAGGTGGG + Intronic
1201547352 Y:15180291-15180313 CTTTAAACTTGCATGAAGGAAGG - Intergenic
1202040145 Y:20674382-20674404 CAGTAAAGTCACATGAAGATTGG - Intergenic