ID: 1043800260

View in Genome Browser
Species Human (GRCh38)
Location 8:84600682-84600704
Sequence ATGACTGAGAGGAATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043800254_1043800260 16 Left 1043800254 8:84600643-84600665 CCATCTGTTAGAGCAAAGCTATG 0: 1
1: 0
2: 1
3: 12
4: 131
Right 1043800260 8:84600682-84600704 ATGACTGAGAGGAATGAGGAGGG No data
1043800253_1043800260 17 Left 1043800253 8:84600642-84600664 CCCATCTGTTAGAGCAAAGCTAT 0: 1
1: 0
2: 0
3: 12
4: 137
Right 1043800260 8:84600682-84600704 ATGACTGAGAGGAATGAGGAGGG No data
1043800256_1043800260 -7 Left 1043800256 8:84600666-84600688 CCAAGCTGATCTGGATATGACTG 0: 1
1: 0
2: 0
3: 10
4: 106
Right 1043800260 8:84600682-84600704 ATGACTGAGAGGAATGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043800260 Original CRISPR ATGACTGAGAGGAATGAGGA GGG Intronic
No off target data available for this crispr