ID: 1043803902

View in Genome Browser
Species Human (GRCh38)
Location 8:84646768-84646790
Sequence AGTTATTGACAGTAGATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 262}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043803902_1043803909 30 Left 1043803902 8:84646768-84646790 CCTTCCATCTACTGTCAATAACT 0: 1
1: 0
2: 1
3: 40
4: 262
Right 1043803909 8:84646821-84646843 CTTTCGCTAAACCCAGTGTTAGG No data
1043803902_1043803904 -2 Left 1043803902 8:84646768-84646790 CCTTCCATCTACTGTCAATAACT 0: 1
1: 0
2: 1
3: 40
4: 262
Right 1043803904 8:84646789-84646811 CTCCCTGCTGTTGCCACTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043803902 Original CRISPR AGTTATTGACAGTAGATGGA AGG (reversed) Intronic
904235462 1:29113808-29113830 AGTTACTGAGAGTGCATGGAAGG + Intronic
905839848 1:41166138-41166160 AGCAATTGACTGTAGATGCATGG + Intronic
906724974 1:48037507-48037529 AGTGAATGACTGGAGATGGATGG + Intergenic
907380901 1:54087364-54087386 AGTTATTGAATCTAGATGAAGGG - Intronic
908318597 1:62959339-62959361 AGTTATTAAGTGTAGATGGAGGG - Intergenic
908941903 1:69445374-69445396 AATTATGGACAGAAGAGGGATGG - Intergenic
911430035 1:97773800-97773822 AGTAACTGTCAGCAGATGGATGG - Intronic
911883569 1:103270447-103270469 AGTTATAGGCAGAAGATGGCAGG - Intergenic
912457745 1:109808954-109808976 AGTCAGTGACAGTAGAGGGCAGG - Intergenic
913306551 1:117433845-117433867 AGTTAGAGACAGGAGATGGTGGG - Intronic
915759344 1:158295239-158295261 AGGCATTGAGAGTGGATGGAGGG + Intergenic
915812560 1:158930228-158930250 AGTTAAAGACAGAAAATGGAGGG + Intergenic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
916230279 1:162534723-162534745 AAATATTGACAGTAGATGAAGGG - Intergenic
916365263 1:164019489-164019511 ATGTATTGAAAGTACATGGATGG + Intergenic
918465682 1:184819137-184819159 AGTGATTGACAGTAGATAGGTGG - Intronic
919124613 1:193379783-193379805 AGTTATCTACAGAAGATGGCAGG + Intergenic
920316920 1:205083120-205083142 AGTAATTCACAGTAGCTGTATGG - Exonic
923282034 1:232452560-232452582 AATTATTGATGGTAAATGGAAGG - Intronic
923543125 1:234903767-234903789 AGTTCCAGAAAGTAGATGGAAGG + Intergenic
923847214 1:237748338-237748360 AGTAAGTGACAGGAGATGTAAGG - Intronic
924625856 1:245695986-245696008 GGGTATTGGCAGGAGATGGAGGG + Intronic
924842152 1:247723735-247723757 AGTCATTAAAAGTAGCTGGAAGG + Exonic
1063692597 10:8301292-8301314 ATATTTTGACAGCAGATGGATGG + Intergenic
1065558338 10:26938608-26938630 AGTTATACCCAGTACATGGAGGG + Intergenic
1066578607 10:36854491-36854513 AGTAGTTGAAAGTAAATGGAAGG - Intergenic
1067353536 10:45501258-45501280 AGTTCTTGAAATTGGATGGATGG - Intronic
1068505309 10:57893041-57893063 TTTCATTGACAGTAGATGCATGG - Intergenic
1069295165 10:66835119-66835141 ATTTCTTGACAGTAAATGGAGGG + Intronic
1070051583 10:72895224-72895246 AGTTATTGGCAGCAGATAGGGGG - Intronic
1071605731 10:86986860-86986882 CGTTACTCACAGTAGCTGGAAGG - Intergenic
1071611915 10:87039276-87039298 AGGCACTGAGAGTAGATGGAGGG - Intergenic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1072547935 10:96454960-96454982 AGTCATTGACAGTGAAAGGAAGG + Intronic
1073816700 10:107214858-107214880 AGACATTGAGAGTGGATGGAGGG - Intergenic
1073863113 10:107770314-107770336 AGTCATTGACAGTGGAGAGAGGG + Intergenic
1075820909 10:125309585-125309607 AATTATTTAAAGTATATGGAAGG - Intergenic
1076010770 10:126986275-126986297 ACTTATTGACAGTGGAGGGGAGG - Intronic
1080185056 11:29472845-29472867 AGTGATTGCCAGTAGCTGGAGGG + Intergenic
1081292870 11:41348649-41348671 AGTCATTGAGAATGGATGGAGGG + Intronic
1082090980 11:48089756-48089778 AGCTGTTCACAGTAAATGGAAGG + Intronic
1082252064 11:49993505-49993527 AGTTATTGACCTTAAAGGGAAGG + Intergenic
1083081484 11:60098712-60098734 AATTATTGACAAAAGATGGCTGG - Intergenic
1086008549 11:82069553-82069575 AGGCATTGACAGTGGATGGAGGG - Intergenic
1086099564 11:83084837-83084859 AGTTATTGAAAGTAGATGCCAGG + Intergenic
1087486536 11:98764435-98764457 GGCTACTGACAGTAGGTGGAAGG + Intergenic
1087824416 11:102748698-102748720 AGTTATTGACTGTAAAGAGAAGG - Intergenic
1087848219 11:102997572-102997594 AGTTAATGAAAGCAGAAGGATGG + Intergenic
1088454184 11:110016329-110016351 AGTGATTCATAGTAGATTGATGG + Intergenic
1091055406 11:132413582-132413604 AGAGACTGACAGCAGATGGATGG + Intergenic
1091997403 12:5004584-5004606 ATTTATGGACAGAAAATGGAAGG + Intergenic
1092178605 12:6428655-6428677 ATTAATTGACAATAGATGTATGG - Intergenic
1092708544 12:11309718-11309740 ATATATTAACAGGAGATGGAGGG - Intronic
1094285999 12:28794320-28794342 ACTTATTGCCAATAGAAGGAAGG - Intergenic
1095622253 12:44271445-44271467 ATTGATTGACCGTAAATGGATGG - Intronic
1095821473 12:46483600-46483622 ACATATTGACAGTAACTGGAAGG - Intergenic
1095829923 12:46573935-46573957 AGTTTGTGGCAGCAGATGGAGGG - Intergenic
1096288710 12:50322933-50322955 AGTTATCTACAGAAGATGGCAGG - Intergenic
1097076998 12:56402414-56402436 AGTTATCGCCAGAAGATGGCAGG - Intergenic
1097897973 12:64844695-64844717 AGAGATAGACAGTAGAAGGATGG - Intronic
1098034918 12:66291937-66291959 AGATATGGACAGCAGATGCAGGG - Intergenic
1101275743 12:103198822-103198844 AGGCATTGAGAGTGGATGGAGGG - Intergenic
1101290151 12:103360159-103360181 AGTTAGAGACAGTGGATGAAGGG + Intronic
1101495698 12:105252138-105252160 AGTCATTGCCAGGAGCTGGAGGG + Intronic
1101708226 12:107240699-107240721 AGCCATGGACAGTAGATGAAAGG + Intergenic
1104288945 12:127450764-127450786 GTTTATTGACAGTATATTGAAGG + Intergenic
1106380990 13:29238932-29238954 AGTGATTGTCAGGGGATGGAGGG + Intronic
1106865584 13:33960513-33960535 ATTCACTGACAGTAGAAGGAAGG - Intronic
1106936056 13:34721430-34721452 AGTAATTGACAGTAGAAGGATGG - Intergenic
1107417987 13:40219183-40219205 AGTTATTGAAAGTGAATGAAGGG + Intergenic
1108200883 13:48041865-48041887 AATTATTTACCGTAAATGGATGG - Intronic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1109293221 13:60500091-60500113 AGTTATCCACAGAAGATGGCAGG - Intronic
1110370074 13:74729934-74729956 AGGTCTTCACAGTACATGGAGGG - Intergenic
1110407033 13:75162266-75162288 TGTTATAGAGAGTAGAAGGAAGG + Intergenic
1110589774 13:77242766-77242788 AGTTATTGATAGTAGGCAGATGG + Intronic
1111711117 13:91815621-91815643 TGTCATTGACAGCAGCTGGAGGG - Intronic
1111734699 13:92123109-92123131 AGTTATTGACACTGGCTGGGTGG + Intronic
1116243443 14:42378513-42378535 AGGCATTGAGAGTGGATGGAGGG + Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1116727317 14:48576575-48576597 ATTTATAGACAGTGGGTGGAAGG - Intergenic
1118140338 14:63073639-63073661 AGTTATTGCCAGTAGGTGAAGGG + Intronic
1120961023 14:90125054-90125076 AATTTTTTACTGTAGATGGAAGG + Intronic
1122625305 14:103082473-103082495 GGTTATTGAACGTAGATGGTGGG + Intergenic
1123673850 15:22688864-22688886 AGTTATTGACACTGGCTGGGTGG + Intergenic
1124325855 15:28761854-28761876 AGTTATTGACACTGGCTGGGTGG + Intergenic
1124986371 15:34620067-34620089 TGTCATTGACAGCAGCTGGAGGG - Intergenic
1128662860 15:69514997-69515019 AGTGATTGCCAGGGGATGGAAGG - Intergenic
1129892310 15:79079327-79079349 AGTTTTTGACAGAAGCTGAAGGG - Intronic
1130306863 15:82718034-82718056 ATAGATTGACAGTAAATGGATGG - Intergenic
1132153069 15:99475912-99475934 AGTGATTGACAGTAGAGGTGAGG - Intergenic
1133410739 16:5566402-5566424 TGGAATTGACCGTAGATGGATGG + Intergenic
1135203627 16:20462887-20462909 CTTTATTCACAGTAGTTGGAAGG + Intronic
1135215378 16:20562049-20562071 CTTTATTCACAGTAGTTGGAAGG - Intronic
1135245398 16:20852115-20852137 AGTCATTGACTGTTGATGGTGGG - Intronic
1138776344 16:59728804-59728826 AGCCATTGAGAGTGGATGGAGGG + Intronic
1142341757 16:89528026-89528048 AGTGATGTACAGAAGATGGAGGG + Intronic
1144681333 17:17197471-17197493 AGTGATTGCCAGGAGCTGGAGGG + Intronic
1145404232 17:22571382-22571404 AGTTTTTGGGGGTAGATGGAGGG + Intergenic
1145977754 17:28994016-28994038 AGAGCTTGACTGTAGATGGAGGG + Intronic
1146013927 17:29217556-29217578 AGTTGTTGGGAGTAGCTGGAGGG - Intergenic
1148129091 17:45252308-45252330 AGTTGTTGACAGGAGTTGGAGGG + Intergenic
1149147050 17:53506582-53506604 ACTTATAGAAAGTAGAAGGATGG - Intergenic
1149363165 17:55914686-55914708 AGGCATTGAGAGTTGATGGAGGG - Intergenic
1149398192 17:56266376-56266398 TGATTTTGACAGTAGAGGGAGGG - Intronic
1150021565 17:61620292-61620314 GTTTATTGAAAGTAAATGGATGG + Intergenic
1150648932 17:66997374-66997396 AGGCAATGAGAGTAGATGGAGGG + Intronic
1151278724 17:73055866-73055888 ATTTATGGACAGAAGATGGAAGG - Intronic
1153206502 18:2708843-2708865 AGTTATTGAAAATAGAAGCAGGG - Intronic
1153410594 18:4788838-4788860 AGGCATTGAGAATAGATGGAGGG + Intergenic
1154060088 18:11051737-11051759 AATTATTGTGAGTAAATGGAAGG + Intronic
1155954450 18:31945313-31945335 AGTGATTGCCAGGAGTTGGAGGG - Intronic
1156030186 18:32704273-32704295 AGTTATTGAGGGCAGAAGGAAGG + Intronic
1156523307 18:37740450-37740472 AGTGATTGAGAGGTGATGGAGGG - Intergenic
1157509709 18:48262119-48262141 AGTCATTGAAAATAGATGTAAGG - Intronic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1159134214 18:64318188-64318210 AGTTATATACAGTGGATTGATGG + Intergenic
1161586071 19:5106568-5106590 AGCTAGTGACAGCAGAGGGAGGG - Intronic
925937627 2:8781397-8781419 AGTTATAGCCAGTTGATTGATGG - Intronic
926608753 2:14923931-14923953 AGTAATTCACAGCAGATGGAGGG + Intergenic
927797912 2:26067548-26067570 AGGTGTTGACAGTTGCTGGAAGG - Intronic
927816397 2:26221349-26221371 AGTTATTCACAGAGGATGGTAGG - Intronic
928805180 2:35141254-35141276 AGTTTTTTACAGATGATGGAAGG - Intergenic
929738220 2:44574441-44574463 AGTTAGTTACAGGAGATGGTTGG + Intronic
930710008 2:54542233-54542255 AGTTGTTGTCAGTAGATGAAAGG + Intronic
932589075 2:73052685-73052707 AATTATGGACCGAAGATGGAAGG - Intronic
933319713 2:80758011-80758033 GGGCATTGAGAGTAGATGGAGGG - Intergenic
934749592 2:96784754-96784776 TGGGATTGACAGTAGATGTAGGG + Intronic
935183932 2:100714870-100714892 AGTTATTTTCAGAAGATGGTAGG - Intergenic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
935651386 2:105385239-105385261 ATTTAGTGACAGTTGAGGGATGG - Intronic
936171331 2:110178880-110178902 ACTTATTGACAGAAGAGGCATGG + Intronic
938246826 2:129783358-129783380 AGTTATTCACATTAAATTGAGGG + Intergenic
939991463 2:148879940-148879962 ATTTCTTGGCAGTAGATGGATGG + Intronic
940194240 2:151075595-151075617 AGTTATTGACTGTAAATGTGTGG - Intergenic
941348082 2:164394939-164394961 AATTTTTGTCAGTACATGGAAGG + Intergenic
942372455 2:175299947-175299969 AATTGTTGCCAGTACATGGAGGG + Intergenic
943324742 2:186484847-186484869 AGTTCTTGTCAGAGGATGGAGGG - Intergenic
944621668 2:201522447-201522469 AGGCATTGAGAGTGGATGGAGGG + Intronic
945487753 2:210417502-210417524 AGCCATTGAGAGTAGATAGAGGG - Intergenic
946141504 2:217694926-217694948 TGTTACTGACAGAAAATGGATGG + Intronic
947273055 2:228360571-228360593 AGTTCTTTCCAGTAGATGCAGGG + Intergenic
947427913 2:230000507-230000529 ATTTACTGAAAGTAAATGGAAGG - Intronic
1168857585 20:1019644-1019666 GGTGATAGACAGTAGATGGATGG - Intergenic
1171722294 20:28575346-28575368 TGTTATTGACAGTAAGAGGATGG + Intergenic
1175704022 20:61162550-61162572 TGTTATTGACACTAGATTCACGG + Intergenic
1176297930 21:5084260-5084282 CGTTATTCACAGTAGCTAGAAGG - Intergenic
1177085042 21:16693213-16693235 AGTTACTGACAGAAGAAAGATGG + Intergenic
1177187694 21:17816507-17816529 AACTATTGACAGTAGATCAATGG + Intronic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1178784050 21:35635841-35635863 AGGGATTGCCAGAAGATGGAGGG + Intronic
1178814250 21:35913002-35913024 AGGTATTGACAGGAAATTGATGG + Intronic
1179859099 21:44177689-44177711 CGTTATTCACAGTAGCTAGAAGG + Intergenic
1180295844 22:10934034-10934056 TGTTATTGACAGTAAGAGGATGG + Intergenic
1180678552 22:17606233-17606255 GGATATTGACAAAAGATGGAAGG - Intronic
1182698848 22:32215858-32215880 AGTTAGTGACAGTAGATGAGAGG + Intergenic
949247696 3:1944623-1944645 AGAAATTGACAGGAGATGTATGG - Intergenic
949743726 3:7264597-7264619 AGACATTGAGAGTAGATGGAGGG - Intronic
951003616 3:17592822-17592844 AGTTATCTACAGAAGATGGCAGG - Intronic
953014492 3:39060240-39060262 AGTAATTGCCAGGAGATTGAAGG - Intronic
953199224 3:40763323-40763345 ACTTATGGAGAGTAGAAGGATGG + Intergenic
956505672 3:69936654-69936676 AATTATAGAAAGTAGAGGGAGGG + Intronic
957311431 3:78524350-78524372 ATTTATTGGCAGAAGATGGAAGG + Intergenic
959194481 3:103161891-103161913 TGTCATTGATAGTTGATGGAAGG - Intergenic
959881351 3:111447987-111448009 AGGCATTGAGAGTGGATGGAAGG + Intronic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
960785927 3:121372670-121372692 AGGCATTGAGAGCAGATGGAGGG - Intronic
962655850 3:137543155-137543177 AGATATTGAGAGTGAATGGAGGG - Intergenic
963180013 3:142345087-142345109 AGTAATTGACTGTAGATGTATGG - Intronic
963401317 3:144802765-144802787 AGGCATTGAGAGTGGATGGAGGG - Intergenic
964233353 3:154496308-154496330 GGTTCTTGAAAGGAGATGGATGG + Intergenic
964264744 3:154881699-154881721 AGTTATATACAGTTGATTGATGG - Intergenic
968782190 4:2591434-2591456 GGGTTTTGACAGGAGATGGAGGG + Intronic
970171101 4:13291218-13291240 AGGCATTGAGAGTAGATGGAGGG - Intergenic
971745081 4:30568835-30568857 AGTTTTTGACAGTAGTTTTAGGG - Intergenic
972083232 4:35181507-35181529 AGGCATTGACAGTGAATGGAGGG + Intergenic
974942936 4:68490201-68490223 AGGCATTGAGAGTTGATGGAAGG - Intronic
975192914 4:71487141-71487163 AATTATTGACAGTGGAGGGACGG + Intronic
975386719 4:73767539-73767561 AGTTATCTACAGAAGATGGCAGG + Intergenic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
976302355 4:83527283-83527305 AGTTTTTAACAGTAGATCCAAGG + Intergenic
976607800 4:86998851-86998873 AGATACTGAAAGTAGAGGGATGG - Intronic
977031619 4:91891377-91891399 AGTTATCTACAGAAGATGGCAGG - Intergenic
979111763 4:116766692-116766714 AGAGATAGACAGTAAATGGATGG + Intergenic
979900509 4:126210429-126210451 AGTTATTGAAAATAGATTAAGGG + Intergenic
980443319 4:132875393-132875415 AGATATAGACAGTAGAAAGATGG + Intergenic
981645350 4:146992058-146992080 AGGTATTGAGAGTGGATGGAGGG - Intergenic
981962806 4:150561998-150562020 AGCCATTCACAGTAGATGAAGGG - Intronic
982473761 4:155825634-155825656 AGTGATTGACAGGAGCTTGAGGG - Intergenic
983420302 4:167507650-167507672 AGGCATTGAGAGTGGATGGAGGG - Intergenic
984502332 4:180571835-180571857 AGTTTTTGACTTGAGATGGATGG - Intergenic
984561029 4:181270565-181270587 AGTTTTTGATAGTAAATGCATGG - Intergenic
985439957 4:189975080-189975102 TGTTATTGACAGTAAGAGGATGG - Intergenic
987240126 5:15988242-15988264 ATTGATTGACTGTAGATGCATGG + Intergenic
988892526 5:35633490-35633512 ATTTATTGAAAGTAAAAGGATGG - Intronic
990701660 5:58481253-58481275 AGTGAATGACAGTATATGTAGGG + Intergenic
991243842 5:64488817-64488839 AGGCATTGAGAGTAGATGGAGGG + Intergenic
993228885 5:85205217-85205239 AGGCATTGAGAGTGGATGGAGGG - Intergenic
993447815 5:88036300-88036322 AGAGATTGAAAGTATATGGAAGG - Intergenic
994291377 5:98032000-98032022 AGTTATCCACAGAAGATGGCAGG + Intergenic
994558073 5:101330526-101330548 AGGCATTGAGAGTGGATGGAGGG + Intergenic
994613611 5:102077313-102077335 AGGCATTGAGAGTGGATGGAGGG + Intergenic
994784046 5:104132863-104132885 AGGCATTGAGAGCAGATGGAGGG - Intergenic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
995977350 5:118055741-118055763 AATTATTGACAGTAGGAGCAGGG - Intergenic
998787144 5:145725123-145725145 AGTTATTGACTGTATGTGAAAGG + Intronic
999540586 5:152567655-152567677 AGTTAGAGACACTAGAGGGAGGG + Intergenic
1000061395 5:157659503-157659525 TGTAATTGACAATAGATGCATGG + Intronic
1000416970 5:160993873-160993895 AGTTATCTACAGAAGATGGCAGG - Intergenic
1001169088 5:169400920-169400942 AGTTATTGGCATAATATGGATGG + Intergenic
1001838821 5:174855707-174855729 AGTTATTCACAGAAGATAGCAGG - Intergenic
1003219762 6:4148774-4148796 AGATATAGAGAGTAGAAGGATGG - Intergenic
1003357458 6:5387009-5387031 ATTTAGTGACAGTGGAAGGAAGG + Intronic
1004082243 6:12406256-12406278 AGTTACTGAGAGTAGTTGGAAGG + Intergenic
1004268184 6:14168054-14168076 AATATTTGACAATAGATGGATGG - Intergenic
1004772713 6:18802376-18802398 AGTGATTGCCAGGAGAGGGAGGG - Intergenic
1005429216 6:25736633-25736655 GGTTCTTAACAGTAGAAGGAAGG - Intergenic
1007074990 6:39060646-39060668 AGGCATTGGCAGAAGATGGAAGG - Intronic
1007695558 6:43730937-43730959 AGTGATTGAAAGTAAAAGGATGG + Intergenic
1008739254 6:54585285-54585307 AGTTATTTTCAGTACATTGAGGG - Intergenic
1009208351 6:60832346-60832368 AGGCATTGAGAGTAGATAGAGGG + Intergenic
1009355509 6:62739879-62739901 AGGCATTGAAAGTAGATGGAGGG + Intergenic
1010682161 6:78809571-78809593 AGGCATTGAGAGTGGATGGAGGG - Intergenic
1010947221 6:81989764-81989786 AGATATTGAATGAAGATGGATGG - Intergenic
1011878145 6:91988559-91988581 AGTCATAGAGAGTAGAAGGATGG + Intergenic
1011897350 6:92246123-92246145 AATAATTTACAGTAGATTGAAGG + Intergenic
1011923192 6:92608130-92608152 GGTCATGGAGAGTAGATGGATGG + Intergenic
1015831830 6:137378094-137378116 AGTTATTCACAGAAAATGGAAGG + Intergenic
1016567581 6:145473442-145473464 AGTTATTGACCATATATAGAGGG + Intergenic
1018281878 6:162195188-162195210 TGTTATTGACAGTATTTGTAGGG - Intronic
1019859634 7:3645678-3645700 AGTTTTTGACTGAAGATGGGAGG + Intronic
1021110346 7:16687202-16687224 AGTTATAGAAACTAGATGGTGGG + Intronic
1021372149 7:19862257-19862279 ACTTATTGCCAGTAGTTGCAGGG - Intergenic
1022877660 7:34552065-34552087 AGGTATTGAAAGTAGTTGTAGGG + Intergenic
1024871555 7:53968474-53968496 AGTTATTGACATTTGATGTGTGG - Intergenic
1026013138 7:66652573-66652595 TCTTATAGACAGTATATGGATGG - Intronic
1026018189 7:66687695-66687717 ATTTATAGACAGTATATAGATGG - Intronic
1027991523 7:85369067-85369089 AGACATTGAGAGTGGATGGAAGG - Intergenic
1028347388 7:89799051-89799073 TGGCATTGAGAGTAGATGGAGGG - Intergenic
1028888558 7:95961469-95961491 AGTTATTGTCATGAGATGGAAGG - Intronic
1029608562 7:101614566-101614588 AGTGGTTGACAGTAGAGGGAGGG + Intronic
1029710422 7:102296150-102296172 GGTTATTGACTGCAGATTGATGG + Intronic
1030421226 7:109309389-109309411 AGGTACTGACAGTGGATGGAGGG + Intergenic
1031547611 7:123069014-123069036 AGGCATTGAAAGTGGATGGAGGG - Intergenic
1034883664 7:154781167-154781189 AGGAATGAACAGTAGATGGATGG + Intronic
1035839302 8:2793572-2793594 AGTTCTTGACTGTAGAATGAGGG - Intergenic
1036936296 8:13005253-13005275 GGTTATAGAGAGTAGAAGGATGG + Intronic
1037394497 8:18427804-18427826 ATTTATTGACAGAAGAATGATGG - Intergenic
1037766569 8:21775834-21775856 AGTGAATAACAGGAGATGGATGG + Intronic
1039222648 8:35351782-35351804 AGTTATTGATAATAAATGCAAGG + Intronic
1040442988 8:47464448-47464470 AGGTACTGACAGTGGATGGAAGG + Intronic
1041536946 8:58937341-58937363 AGTTTTTGACAGTAGGTTGGTGG + Intronic
1042884086 8:73528511-73528533 AGTTTTTGACAGTGGATAAATGG - Intronic
1043803902 8:84646768-84646790 AGTTATTGACAGTAGATGGAAGG - Intronic
1044224214 8:89701201-89701223 AGGAATTGAGAGTGGATGGAGGG - Intergenic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1046597134 8:116273584-116273606 AGGCATTGAGAGTGGATGGAAGG - Intergenic
1047576576 8:126162241-126162263 AGTCAGTGAAAGAAGATGGAAGG + Intergenic
1049348218 8:142150243-142150265 AGTGATGGATAGTGGATGGATGG + Intergenic
1050237949 9:3602553-3602575 AGTTCTGGAAAGTCGATGGAGGG + Intergenic
1052543532 9:29843286-29843308 AGGCATTGAGAGTGGATGGAGGG + Intergenic
1053530686 9:38878522-38878544 AGGTATTGAGAGTGGAGGGAGGG + Intergenic
1053610815 9:39711399-39711421 AGTTATTCACAGAAGATGGCAGG - Intergenic
1053868851 9:42469421-42469443 AGTTATTCGCAGAAGATGGCAGG - Intergenic
1054087439 9:60759759-60759781 AGTTATTCGCAGAAGATGGCAGG + Intergenic
1054202909 9:62102955-62102977 AGGTATTGAGAGTGGATGGAGGG + Intergenic
1054242707 9:62630996-62631018 AGTTATTCACAGAAGATGGCAGG + Intergenic
1054556832 9:66665514-66665536 AGTTATTCACAGGAGATGGCAGG + Intergenic
1054635454 9:67485410-67485432 AGGTATTGAGAGTGGATGGAGGG - Intergenic
1056733641 9:89186001-89186023 TCATATTGACAGTAGAGGGAGGG + Intergenic
1057470454 9:95351572-95351594 AGATGTTGACTGTGGATGGAAGG - Intergenic
1057971356 9:99561374-99561396 AGTCATTGACAGGAAGTGGATGG + Intergenic
1058218185 9:102261054-102261076 ATTTATGGAAAGTAGAAGGAAGG - Intergenic
1059853562 9:118369975-118369997 TGTTATTGACAGAGGCTGGAGGG + Intergenic
1060229856 9:121818590-121818612 AGTTCTTGGAAGTAGATGGAAGG + Intergenic
1203447479 Un_GL000219v1:72258-72280 TGTTATTGACAGTAAGAGGATGG + Intergenic
1187004419 X:15217986-15218008 ATTAATGGACAGTAGATGGATGG + Intergenic
1188147453 X:26630798-26630820 AGGCACTGACAGTAGATGGATGG - Intergenic
1188833651 X:34931442-34931464 AGGCATTGAGAGTAGATGGAGGG + Intergenic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1189872785 X:45401925-45401947 AGGTATTGATATAAGATGGAGGG - Intergenic
1190218537 X:48496015-48496037 AGTTCTTGACAGGAAATGGTGGG + Intergenic
1190996751 X:55617499-55617521 AGTTATCTACAGAAGATGGCAGG + Intergenic
1191722920 X:64249348-64249370 AGGCATTAAGAGTAGATGGAGGG - Intergenic
1191884979 X:65878991-65879013 ATTTATGGACAGCACATGGAGGG + Intergenic
1191919501 X:66239355-66239377 AGATACTGAGAATAGATGGAAGG - Intronic
1193560823 X:83013928-83013950 AGATATTTTCTGTAGATGGAAGG - Intergenic
1193575856 X:83194407-83194429 AGTCATTGAGAGTAGAGGGAGGG - Intergenic
1194167188 X:90532195-90532217 AGATATAGAGAGTAGAAGGATGG + Intergenic
1194379126 X:93173223-93173245 AGACATTGAGAGTAGAAGGATGG + Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1194774250 X:97943840-97943862 AGACATTGAGAGTGGATGGAGGG + Intergenic
1195144404 X:101999279-101999301 AGACATTGAGAGTAGATGGAGGG + Intergenic
1196518034 X:116636787-116636809 AGTGTTTGACAGGAGCTGGATGG + Intergenic
1196574025 X:117297534-117297556 GGATATTGAGAGTAGAGGGATGG - Intergenic
1196574551 X:117302736-117302758 AGGCATTGAGAGTGGATGGAGGG - Intergenic
1197034016 X:121853499-121853521 AGGCATTGAGAGTGGATGGAGGG + Intergenic
1197374256 X:125663275-125663297 AGAAATTGAGAGTAAATGGAGGG + Intergenic
1199136929 X:144265281-144265303 AGGCATTGAGAGCAGATGGAGGG + Intergenic
1200513452 Y:4109971-4109993 AGATATAGAGAGTAGAAGGATGG + Intergenic
1201945526 Y:19505571-19505593 AGTTATTGACTTTGAATGGATGG - Intergenic
1201964347 Y:19715593-19715615 AGTGAGTGACAGGAAATGGAAGG - Exonic
1202186929 Y:22195534-22195556 AGTGATAGAATGTAGATGGATGG + Intergenic
1202204431 Y:22390862-22390884 AGTGATAGAATGTAGATGGATGG - Intronic