ID: 1043804497

View in Genome Browser
Species Human (GRCh38)
Location 8:84654572-84654594
Sequence AGGGAAAGAGCAGTGGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043804497_1043804504 14 Left 1043804497 8:84654572-84654594 CCTACCACCACTGCTCTTTCCCT No data
Right 1043804504 8:84654609-84654631 TCCTTCTACTTTACATCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043804497 Original CRISPR AGGGAAAGAGCAGTGGTGGT AGG (reversed) Intronic