ID: 1043804497

View in Genome Browser
Species Human (GRCh38)
Location 8:84654572-84654594
Sequence AGGGAAAGAGCAGTGGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 691
Summary {0: 1, 1: 0, 2: 5, 3: 59, 4: 626}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043804497_1043804504 14 Left 1043804497 8:84654572-84654594 CCTACCACCACTGCTCTTTCCCT 0: 1
1: 0
2: 5
3: 59
4: 626
Right 1043804504 8:84654609-84654631 TCCTTCTACTTTACATCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043804497 Original CRISPR AGGGAAAGAGCAGTGGTGGT AGG (reversed) Intronic
901556181 1:10033013-10033035 GGGGAAAGAGTAGGGGTGGAGGG + Intronic
901914324 1:12486514-12486536 AGGAAAAGAACAGTGGGGCTTGG - Intronic
902472234 1:16657017-16657039 AGGGAAAGAGCAGGAATGGGTGG + Intergenic
902486569 1:16750429-16750451 AGGGAAAGAGCAGGAATGGGTGG - Intronic
902562363 1:17285578-17285600 CGGGGCAGTGCAGTGGTGGTGGG + Intergenic
902605804 1:17568765-17568787 AGGGAAAGAGGACGGGTGTTTGG + Intronic
903009294 1:20318825-20318847 AGGGAAAGAGTCGGGGTGGGGGG + Intronic
903143178 1:21352274-21352296 AGAGAAAGGGCAGAGGTTGTGGG + Intergenic
903324883 1:22563892-22563914 AGGGACAGAGCGGTGGAGATGGG + Intronic
903691127 1:25174402-25174424 AGGGGATGGGGAGTGGTGGTGGG + Intergenic
904030745 1:27532147-27532169 AGGGAGAGGGAAGTGATGGTAGG - Intergenic
904058507 1:27687843-27687865 AGGGATGGTCCAGTGGTGGTGGG + Intergenic
904574753 1:31498078-31498100 GGGGACAGAGAAGTGGTGCTGGG - Intergenic
904601406 1:31674634-31674656 GGTGAAAGTGCAGTGGTGGGGGG - Intronic
904604824 1:31692561-31692583 AGGGATAGGGCAGGGATGGTGGG - Intronic
904684018 1:32247913-32247935 GGGGACAGAGCACTGGTGTTGGG + Intronic
904945388 1:34195378-34195400 ATGAAAAGAGCAGTGGTGCCTGG + Intronic
906608554 1:47187257-47187279 AGAGCAAGAGCAGTGGTCCTGGG + Intronic
906647608 1:47487029-47487051 AGGGAAAGAGAAGGGGGGATGGG - Intergenic
906666891 1:47628290-47628312 TGGGAAAGAGGCCTGGTGGTTGG - Intergenic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
906841669 1:49146092-49146114 ATGGGAAGAGTAGTGGGGGTTGG + Intronic
907303590 1:53502375-53502397 AGGGAAAGAGGAGAGGGGGGAGG + Intergenic
907303618 1:53502455-53502477 AGGGAAAGAGGAGAGGGGGGAGG + Intergenic
907303652 1:53502554-53502576 AGGGAAAGAGGAGAGGGGGGAGG + Intergenic
907487531 1:54787952-54787974 AGGGTAAGGGCAGAGGTGGCTGG - Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
907763904 1:57389383-57389405 AGGAATTGAGCTGTGGTGGTAGG - Intronic
908256563 1:62308366-62308388 AGGACAAGAGCAGGGGTGGGAGG + Intronic
908722807 1:67144769-67144791 AGGGAAAGAGAATAGGTTGTGGG - Intronic
908896265 1:68903709-68903731 AGTAAAAGAGCAGTGGGAGTAGG - Intergenic
909228537 1:73057543-73057565 AAGGAAAGAGCAGTTGTCCTCGG + Intergenic
909836977 1:80268043-80268065 AGGGCAAGAGTAGTGATGCTGGG - Intergenic
909842846 1:80350971-80350993 AAGGAGAGAGAAGGGGTGGTGGG - Intergenic
910070997 1:83213380-83213402 AGGGAATGAGCAGTGGCTGAGGG + Intergenic
911442103 1:97939612-97939634 TAAGAAAGATCAGTGGTGGTAGG + Intergenic
911872928 1:103121901-103121923 ATGGAAAAAGCAGTGTTGGAGGG + Intergenic
913585569 1:120272263-120272285 AGGGGAAGGGAAGTGGAGGTGGG - Intergenic
913622615 1:120626104-120626126 AGGGGAAGGGAAGTGGAGGTGGG + Intergenic
914044382 1:144078232-144078254 GGGGAAAAAGCCGTGGTGGCAGG - Intergenic
914133728 1:144882455-144882477 GGGGAAAAAGCCGTGGTGGCAGG + Intergenic
914243265 1:145866999-145867021 AGTGAAAGATGAGTGATGGTAGG - Intronic
914567575 1:148884122-148884144 AGGGGAAGGGAAGTGGAGGTGGG - Intronic
914605247 1:149246123-149246145 AGGGGAAGGGAAGTGGAGGTGGG + Intergenic
914902563 1:151718825-151718847 AGGAAAGGAGCAGTGGGGGTGGG - Intronic
915165810 1:153947068-153947090 TGGAATAGAGCAGTGGAGGTGGG + Intergenic
915218154 1:154353433-154353455 ATGGAAGGTGCAGTGGTGGGAGG - Intergenic
915476546 1:156155962-156155984 AGGAAGAAAGCAGGGGTGGTTGG + Intronic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916128820 1:161593583-161593605 AGGGAGGGAGCAGCGGTGGGAGG + Intronic
916168675 1:161984766-161984788 AGGGAAGGAGCAGTCTGGGTTGG + Intronic
917046653 1:170867994-170868016 AGGGCAGGAACAGTGGTGCTGGG + Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
917546145 1:175970258-175970280 AGGGAAAGAGAAGCAGTGATTGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
918105891 1:181414923-181414945 ATGGTAAGAGCACTGGTGTTGGG + Intronic
918774365 1:188609690-188609712 AGGGTGAGGGCAGTTGTGGTGGG + Intergenic
919047384 1:192470421-192470443 AGGGAAAGTGAAGTGATTGTGGG - Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
919133649 1:193481891-193481913 AGGCAAAGAACAGTGTTGATTGG + Intergenic
920029700 1:203029073-203029095 GGGGAAACAGCAGTGGGGGAAGG + Intronic
920127206 1:203702754-203702776 AGTGAAAGTGGAGTGGTGCTGGG + Intronic
920350194 1:205332870-205332892 GGGGAAAGAGAAGTGATGGAGGG + Intergenic
920436603 1:205950873-205950895 AGAGAAAGGGCAGTGTTAGTGGG - Intergenic
920543957 1:206800345-206800367 TGGGGCAGGGCAGTGGTGGTGGG + Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921281660 1:213573740-213573762 AGGGACAGAGAGGTGGGGGTAGG + Intergenic
922226065 1:223646794-223646816 AGGCAGAGAGCAGAGCTGGTAGG + Intronic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923062348 1:230487543-230487565 ATGGAGAAAACAGTGGTGGTTGG + Intergenic
923524825 1:234764429-234764451 AGGGAGAGAGCATAGGTGGTGGG - Intergenic
924602629 1:245504733-245504755 AGGGAAAGAGCAGAGAGGCTGGG - Intronic
1063674190 10:8125212-8125234 TGGGAAGGAGCACGGGTGGTGGG + Intergenic
1063908260 10:10802802-10802824 AGGGAGACAGAAGTGGAGGTGGG - Intergenic
1064580216 10:16786191-16786213 AGGTCAAGAGCATTGGTGCTGGG + Intronic
1065200998 10:23313042-23313064 AGGGAAAGAGAAGAGAGGGTGGG - Intronic
1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG + Intergenic
1066028675 10:31394037-31394059 AGCTAAAGAGGAGTGATGGTGGG + Intronic
1066244767 10:33571710-33571732 AGGCAAAGAGCAGGGGTGAGGGG - Intergenic
1066780714 10:38942550-38942572 TGGGAGAAAGCAGTGGCGGTGGG - Intergenic
1066950314 10:42111218-42111240 GGGGAAAAAGCCGTGGTGGCAGG + Intergenic
1066950468 10:42111917-42111939 GGGCAAAAAGCCGTGGTGGTGGG + Intergenic
1067272525 10:44804603-44804625 GGGGAAAGTGCAGAGGAGGTGGG - Intergenic
1067497579 10:46773969-46773991 AGGGAGAGAGCAGGGGCGGTGGG + Intergenic
1067597072 10:47566446-47566468 AGGGAGAGAGCAGGGGCGGTGGG - Intergenic
1067721710 10:48732308-48732330 AGGGAAAGACCAGAGGAGCTGGG - Intronic
1068665334 10:59669027-59669049 AAAGAAAGGGCAGTGGTGGGAGG + Intronic
1068787224 10:60989778-60989800 GGGGAGAGAGCAGGGGTGGAGGG - Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1069193570 10:65520302-65520324 AGGGAGAGAGCAGTGATAGTGGG - Intergenic
1069803770 10:71103838-71103860 AAGGTGAGAGCATTGGTGGTTGG - Intergenic
1069899820 10:71701048-71701070 TGGACAAGATCAGTGGTGGTGGG - Intronic
1070784683 10:79156068-79156090 AGGTAAAGAGTAGGGGTGGGAGG - Intronic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071561544 10:86649916-86649938 AGGGGCAGAGCAGAGGTGATGGG + Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072959698 10:99918203-99918225 AGAGGAAAAGCAGTGGGGGTTGG - Intronic
1074447251 10:113530616-113530638 AGGGAAAGAGCAGTAGGGGAGGG + Intergenic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1075932638 10:126312316-126312338 AGGGAAGGAGCAGGTGTGCTTGG - Intronic
1076181413 10:128411777-128411799 AGGAGCAGAGGAGTGGTGGTGGG + Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1077249839 11:1556065-1556087 AGGGAGGGAGCAGGGGAGGTGGG + Exonic
1077274790 11:1699511-1699533 AGGGAAAGAGATGCAGTGGTAGG - Intergenic
1078034048 11:7784012-7784034 AGAGAAGAAGCAGAGGTGGTTGG + Intergenic
1078182273 11:9022117-9022139 AGGTGAAGAGAGGTGGTGGTGGG - Intronic
1078222251 11:9361717-9361739 GGGGAAGGAGAAATGGTGGTGGG - Intergenic
1079433311 11:20418941-20418963 TGAGAAAGAGCAGTGGAGGTGGG - Intronic
1079503192 11:21125626-21125648 TGGGAAAGAGCATTGGTACTGGG + Intronic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1079737513 11:24014463-24014485 AGGTAAGGAGCACTGGGGGTTGG + Intergenic
1080485797 11:32705125-32705147 CGGGAAACAGCAGTGGGGCTAGG + Intronic
1080576482 11:33604062-33604084 AGGGAAAGCTCAGAGGTGGAAGG + Intronic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1082784001 11:57306884-57306906 AGGCAGAGAGCTGTGGTGGTGGG + Intronic
1083879572 11:65541355-65541377 GGGGAAAGACCTGTGGTGGGTGG - Intronic
1083882454 11:65555291-65555313 AGGGAAGGAGCAGAGGGGGATGG - Intronic
1084085242 11:66852085-66852107 AGGGAAAAATCTGTGGGGGTTGG - Intronic
1084359579 11:68660816-68660838 AGAGAAAGTGCAGAGGTGGACGG + Intergenic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1084959185 11:72707331-72707353 AGAGAAGGAGCAGTGGTTGGAGG - Exonic
1084971759 11:72775965-72775987 AGGGAAAGATCAGAGGTGGCTGG - Intronic
1085517388 11:77119423-77119445 AGGGGAAGATTACTGGTGGTTGG + Intronic
1085522595 11:77147113-77147135 AGGGCAGTAGCAGTGGTGATGGG - Intronic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1085653071 11:78286033-78286055 AGGGAAAGAGCGATGGAGGAAGG - Intronic
1085832875 11:79920564-79920586 AGGAAATGAGGAGTGCTGGTAGG + Intergenic
1086123070 11:83320588-83320610 CTGGGAAGGGCAGTGGTGGTTGG - Intergenic
1086218018 11:84406876-84406898 AGAGAAAGAGAAGAGGTGGAAGG + Intronic
1086448303 11:86890811-86890833 AGAGAAAGTCCAGTGGTGGTGGG - Intronic
1087080742 11:94168798-94168820 AGGGTGACAGCAGTGGAGGTGGG + Intronic
1087163385 11:94973429-94973451 CGGGAAAGGGCAGTTGGGGTCGG - Intronic
1087803929 11:102534996-102535018 AGGGAAACAGATGTGGTCGTGGG + Intergenic
1087842484 11:102934792-102934814 AAGGAAATAGAAGTGTTGGTAGG + Intergenic
1088441030 11:109870477-109870499 AGGGAAAGGGTAGAGGCGGTGGG - Intergenic
1089046507 11:115505277-115505299 AGGTGAAGAGCGGGGGTGGTGGG + Intergenic
1090460618 11:126888479-126888501 AAGGAAAGAGCAGTGTGGGGTGG - Intronic
1090953983 11:131498578-131498600 AGGGAAAGAGCAGATGTAATGGG - Intronic
1091078107 11:132640238-132640260 AGGCAATGAGCAGTGTGGGTGGG + Intronic
1091435644 12:470582-470604 TGGGAAAGGGCAGTGGAGATGGG + Intronic
1091655964 12:2347227-2347249 GGGGAAAGTGCAGTGTTCGTGGG - Intronic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1093292903 12:17350680-17350702 AGGGCATGAGGAGTGGTGTTTGG + Intergenic
1093817115 12:23562275-23562297 AGGGAAAGAGCAGTTGTGGCAGG + Intronic
1094113279 12:26883806-26883828 ATGGAAAGAGGACTGGTGGCTGG + Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095726558 12:45460125-45460147 AGGAGAAGAATAGTGGTGGTTGG + Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096686777 12:53293197-53293219 AGGAAAACACCATTGGTGGTGGG - Intronic
1096860988 12:54527961-54527983 TGGAAAAGAGCAGTGGTTGAGGG + Intronic
1097267425 12:57754535-57754557 AGGGAGGGAGCAGGGGAGGTAGG - Intronic
1097882353 12:64697974-64697996 AGGGCAAGAACAGGGGTGGAGGG - Intergenic
1098763611 12:74456569-74456591 ACAGAAAGAGAAGTGGGGGTGGG - Intergenic
1100391705 12:94149938-94149960 AGGCAGAGCGCCGTGGTGGTGGG - Exonic
1101225711 12:102686319-102686341 GGGGAAAGGGCAGTGGTGGTAGG - Intergenic
1101284229 12:103293540-103293562 AGGGAGAGATCAGTTCTGGTTGG - Intronic
1101621883 12:106396627-106396649 AGAGAAAGAGGAGTGGGGTTAGG + Intronic
1101854763 12:108432956-108432978 AGGGCAACAGCAGAGGAGGTAGG + Intergenic
1102481280 12:113225398-113225420 ATGTAAAGAGAAGTGGAGGTAGG + Intronic
1102660534 12:114523650-114523672 AGGGAAACAGAAGTGGTTCTGGG + Intergenic
1103000497 12:117382090-117382112 AGGTAAAGAGCAGGGGTGGTGGG - Intronic
1103606096 12:122087174-122087196 AGGGAAAAAGCATTTGTGCTGGG - Intronic
1104783883 12:131437639-131437661 TGGGAAGGATCAGTGGTGTTTGG + Intergenic
1104980888 12:132572708-132572730 AGGGAAAGGGGGGTGGTTGTGGG - Intronic
1105214059 13:18274130-18274152 AGGGAAAGAGCAGGAGCGGCCGG + Intergenic
1106793874 13:33184282-33184304 AGGGACAGGTCTGTGGTGGTTGG + Intronic
1107025405 13:35796484-35796506 AGGGAACGAGCAGAGGTGCGGGG + Intronic
1107753947 13:43599324-43599346 AGGGAGAGTGCAGCGATGGTGGG - Intronic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1108074630 13:46667017-46667039 AGGGAAAGTGAAGAGCTGGTTGG + Intronic
1108293512 13:48987611-48987633 AAGGAAAGAGTAGTGTTGGTCGG - Intronic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111441104 13:88283409-88283431 AGGGAATGAACAGTGTTGGCTGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1113909986 13:113837114-113837136 AGGGATAGAGCAGTGATGGGAGG + Intronic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114601262 14:23957115-23957137 AGGTTTAGAGCAGTGGCGGTGGG + Intronic
1114610947 14:24039901-24039923 AGGTTTAGAGCAGTGGCGGTGGG + Intergenic
1114873929 14:26691827-26691849 GGGGAAAGAGCAGTCATGGCTGG + Intergenic
1115211036 14:30967287-30967309 GGGGAAAGAGAGGCGGTGGTGGG + Intronic
1115715020 14:36094015-36094037 AGGGAGAGAGCAGGTGTGTTGGG + Intergenic
1116420790 14:44729415-44729437 TGTTAAATAGCAGTGGTGGTAGG - Intergenic
1117060688 14:51959526-51959548 AGAGTAATAGCAGTGGAGGTGGG - Intronic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1117502561 14:56367955-56367977 AGGGATACAGCAGGAGTGGTGGG - Intergenic
1117607108 14:57440959-57440981 AGAGAAAGAACAGTGATTGTGGG - Intergenic
1118447916 14:65868470-65868492 AGGGAAAGAGGTGTTGTGGGTGG + Intergenic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119323193 14:73743589-73743611 AGGGACAGGGCAGCGGGGGTGGG - Intronic
1121522705 14:94597404-94597426 AGGGAAAGAGAAGGTGGGGTGGG + Intronic
1122029797 14:98903772-98903794 AGAGAAAGAGAAGTGGGGTTGGG - Intergenic
1122299363 14:100723250-100723272 AGGGCAAGAGCAGGGGTGGCCGG - Intergenic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1123586491 15:21765057-21765079 AGGGAAGGAACTGTGGGGGTGGG - Intergenic
1123623130 15:22207622-22207644 AGGGAAGGAACTGTGGGGGTGGG - Intergenic
1123790172 15:23711821-23711843 AGGCAAGGAGGAGTGGTGGAAGG + Intergenic
1124018454 15:25898387-25898409 AGGCAAAGAGCAGGAGTGGTGGG + Intergenic
1124103055 15:26713239-26713261 AGGGGAAGGGCAGTGGTAGTGGG + Intronic
1124222584 15:27863164-27863186 AGGCACAGAGCAGCGGTGGGAGG + Intronic
1124348595 15:28939037-28939059 AGGGAAAGTAGAGTGGTGGCTGG - Intronic
1125169459 15:36749856-36749878 AAGGAAAGGGCATTGGTGCTGGG + Intronic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1126929057 15:53626463-53626485 CGGCAAAGAACAGTGGTGGACGG + Intronic
1127147815 15:56042973-56042995 GGGGAGAGCCCAGTGGTGGTGGG - Intergenic
1128321287 15:66696549-66696571 AGGGTGAGAGCAGTGGACGTGGG - Intergenic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1129903308 15:79168331-79168353 AGGGCAAGAGCATGGCTGGTTGG + Intergenic
1129933455 15:79431175-79431197 AGGGAAGGAGGTGGGGTGGTGGG + Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1131829310 15:96344150-96344172 AGTGAAGAAGCAGTGGGGGTTGG + Intergenic
1131944800 15:97608397-97608419 AAGGAAAGTGCAGTGATTGTGGG + Intergenic
1132100808 15:99021672-99021694 AGGAGAAGAGCAGTGGTGGGTGG - Intergenic
1132162494 15:99556101-99556123 AGGGAAACAGCAGGGGCCGTGGG + Intergenic
1132473994 16:123322-123344 AGAGAAAAAGCCGGGGTGGTGGG + Intronic
1132518573 16:377167-377189 AGGGAAAGAACAGGTGTGGGCGG + Intronic
1134186606 16:12089837-12089859 AGGGAAGGAGCAGTGAAGGACGG - Exonic
1134222344 16:12364874-12364896 AGTGAGAGAGCGGAGGTGGTGGG - Intronic
1134662271 16:15993040-15993062 AAGGAAAGAGCAGGGGTGTCAGG - Intronic
1135057373 16:19241870-19241892 GGGGAACGGGCAGTGGTGGTGGG - Intronic
1135657356 16:24262517-24262539 AGGGTAGGTGCAGTGGTGGTGGG - Intronic
1136922410 16:34343974-34343996 AGGGAGTGTGCAGTGGTGGGGGG - Intergenic
1136982163 16:35067832-35067854 AGGGAGTGTGCAGTGGTGGGGGG + Intergenic
1137299955 16:47139379-47139401 AGGAAAATAACAGTGGTGGCAGG - Intronic
1138825642 16:60315999-60316021 AAGGAAAGAGATGTGGGGGTTGG + Intergenic
1139120212 16:64007268-64007290 AGAGAGAGAGAAGTGGGGGTAGG - Intergenic
1139217986 16:65148092-65148114 GGGGTCAGAGGAGTGGTGGTTGG + Intergenic
1139480818 16:67229723-67229745 AGGGACAGAGCAGGGTTGGAGGG + Intronic
1139613738 16:68076578-68076600 AGGGAGGGAGCGGTGATGGTGGG + Intronic
1140594344 16:76391343-76391365 TGGGAAAGAACATTGGAGGTGGG - Intronic
1140711851 16:77686022-77686044 AGAGAGAGTCCAGTGGTGGTGGG - Intergenic
1141251956 16:82367397-82367419 AGGCACAGAGCAGTGAGGGTTGG - Intergenic
1142065232 16:88058601-88058623 ATGGAAAGAACGATGGTGGTGGG - Intronic
1143833374 17:9670416-9670438 AGTGGGAGAGCAATGGTGGTTGG + Intronic
1145785447 17:27590898-27590920 ATGGGAAGAGGAGTGGGGGTGGG + Intronic
1145787149 17:27601561-27601583 AGGGCAAGTGCCCTGGTGGTAGG + Intronic
1145943624 17:28757677-28757699 AGGGCAAGTGCAGTGGCTGTGGG + Exonic
1146137993 17:30340114-30340136 GGGGAAAGGGCATTGGTTGTGGG - Intergenic
1146401500 17:32503480-32503502 AGGGAAAATGCAGTGGAAGTGGG + Intronic
1146587092 17:34091611-34091633 TGAGAAAGAAAAGTGGTGGTGGG - Intronic
1146663198 17:34678860-34678882 AGAGAAAGAGCACTGGGGCTGGG - Intergenic
1147280896 17:39360194-39360216 AGAGAAAGGATAGTGGTGGTTGG + Intronic
1147379243 17:40043446-40043468 AGGGACAGTCCAGGGGTGGTGGG + Intronic
1148102719 17:45102523-45102545 AGAGAAAGAGCAGTGAGTGTGGG + Intronic
1148326191 17:46784743-46784765 GGGGAAAGCGCAGAGGAGGTAGG - Intronic
1148680779 17:49472408-49472430 AGGGGCAGAGCTGTGGTGGGAGG + Intronic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1151412808 17:73942423-73942445 AAGCAAAGAGCAGTGGTTGTTGG + Intergenic
1151645304 17:75426713-75426735 AGGGAGAGAGCAGTCTTGTTGGG - Intergenic
1152060484 17:78070501-78070523 ACAGAAAGAGCAGTGGGGGTGGG - Intronic
1153308556 18:3655077-3655099 TGGGAAATTGCAGTGGGGGTTGG - Intronic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1156339349 18:36197194-36197216 AAGGCATCAGCAGTGGTGGTGGG + Intronic
1156362939 18:36400406-36400428 CAGGAAAGAGCTGTGGGGGTAGG - Intronic
1156637476 18:39048899-39048921 AGGGAATGAGGGGTGGGGGTTGG + Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158470799 18:57735192-57735214 AGCAAAACAGCAGTGGTGGACGG - Intronic
1159086781 18:63801625-63801647 AGGGAATGAGCACTGTTGATTGG + Intronic
1160738067 19:673804-673826 AGGGGGAGAGCAGTGGGGGGTGG - Intergenic
1160974520 19:1786151-1786173 ATGGAAAGAGCTCTGGAGGTTGG + Intronic
1161345403 19:3766692-3766714 AGGGACAGAGCCGGGGTGTTTGG + Intronic
1161661125 19:5546931-5546953 GTGGAAAGAACAGGGGTGGTGGG + Intergenic
1162180526 19:8865806-8865828 AGGTAAAGAGCAGTGGAGGGAGG + Intronic
1163372352 19:16908461-16908483 AGGGCATGAGCAGGGCTGGTGGG - Intronic
1163556545 19:17996737-17996759 AGGGTAAGGTCAGTGGTGCTAGG + Intronic
1163944238 19:20521174-20521196 ATGGAAAGAGGAGTGGTGAAAGG + Intergenic
1164062762 19:21689826-21689848 TGGGAACAAGGAGTGGTGGTGGG + Intergenic
1164718898 19:30416847-30416869 ATGGAAAGTGCAGTGGTAGAGGG - Intronic
1164907468 19:31978825-31978847 AGGGAAAGCCCAAAGGTGGTAGG - Intergenic
1165187622 19:34035671-34035693 AGGGAAAGGGCACTGCTGATTGG + Intergenic
1165349035 19:35266811-35266833 AGGGACAGGGGGGTGGTGGTCGG - Intronic
1165393197 19:35549950-35549972 AGAGAAAGCCCAGAGGTGGTAGG + Intergenic
1166287194 19:41838470-41838492 AGGGAGAGAGGAGTGGGGGCTGG - Intronic
1166670242 19:44705532-44705554 AGGGAAGGAGGAGTGGAGGTTGG - Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168355047 19:55695448-55695470 AGGGGAAGGGCACTGGGGGTGGG - Intronic
1202669783 1_KI270709v1_random:40107-40129 AGGGAAAATGCCGTGGTGATGGG - Intergenic
1202683932 1_KI270712v1_random:31623-31645 GGGGAAAAAGCCGTGGTGGCAGG - Intergenic
1202704630 1_KI270713v1_random:13811-13833 AGGGAAAGAGCAGGAATGGGTGG + Intergenic
925222952 2:2157448-2157470 AGGGGAAAAGCAGAGGTGGGAGG + Intronic
925245350 2:2377701-2377723 AGGGAAACAGAAGGGGTGGGAGG + Intergenic
926013221 2:9424369-9424391 AGAGAAAGTGCAGAGGTGTTAGG + Intronic
926130171 2:10297995-10298017 GGGGAAAGAGCGGGGGTGGGGGG + Intergenic
926975818 2:18515848-18515870 AGGGACAGTGCAGTTGTGTTCGG - Intergenic
927210415 2:20635775-20635797 ATGGAGAGAGCGGTGGTGTTGGG + Intronic
927291094 2:21405604-21405626 AGGGAAAGACCAGGGGTGAAGGG + Intergenic
927469501 2:23362454-23362476 GGGGAGAGAGCAGTGGTGCCAGG + Intergenic
927478103 2:23429371-23429393 AGGGACAGAGCTTTGGTTGTGGG + Intronic
927877335 2:26667060-26667082 AGGGACAGAGCAGGAGTAGTAGG - Intergenic
927914927 2:26929575-26929597 AGGGATGGGGCAGTGGTGGTGGG - Intronic
928451639 2:31383370-31383392 GAGGAAAGAGCATTGGTTGTAGG - Intronic
929042293 2:37757060-37757082 AGGGATAGTGCAGAGTTGGTGGG + Intergenic
929243187 2:39673742-39673764 AGGGTAGGGGCAGTGGTGGATGG + Intronic
929379273 2:41331175-41331197 AGGGAAAAAGGGGAGGTGGTAGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
929687563 2:44047658-44047680 AGGGAAAGGGCATTGGGGGTGGG - Intergenic
929720500 2:44362463-44362485 AGGAAAAGAGCAGTGGGGAGCGG - Intronic
929824043 2:45296187-45296209 AAGGAAAGGGCAGAGGTGGAAGG - Intergenic
930124855 2:47787617-47787639 AGGGCAGGAGCAATGGTGGCAGG + Intronic
930411553 2:51031854-51031876 AGGGAAAGATGGGTGGTGGGAGG - Intronic
930641150 2:53855642-53855664 AGGCTAAGAGAAGTGGGGGTAGG + Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931375630 2:61705321-61705343 AGGGACAGTCCAGTGGTGGCCGG + Intergenic
931472581 2:62553861-62553883 AGGGAAAGGGCAGTGGGAATGGG - Intergenic
932083018 2:68732485-68732507 CGAAAAAGAGCAGTGGTGTTTGG + Intronic
932889379 2:75579003-75579025 AGAGAAAGTGCAGTGATTGTGGG + Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
933890508 2:86764682-86764704 AGGAAAAGAGCAGTGGATCTAGG + Intronic
933897526 2:86825111-86825133 GGGAAAAGAGCAGGGGTGATGGG + Intronic
934300260 2:91772620-91772642 AGGGAAAGAGCAGGAGCGGCCGG - Intergenic
935175335 2:100643965-100643987 AGGAAGGGAGCAGGGGTGGTGGG - Intergenic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
937577451 2:123441204-123441226 ATGGGAAGAGCAGTGGGGGAAGG + Intergenic
938000734 2:127733920-127733942 AGGGTTAGGGCAGTGGTGGGAGG + Intronic
938774263 2:134527519-134527541 AGGGGAAGAGCAGCTGTGGCAGG + Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939153204 2:138496456-138496478 AGAGAAAGAGGAGTTGTGGTTGG - Intergenic
940107566 2:150116245-150116267 ATGGAAAGAGCAGTGGGGAAAGG - Intergenic
940303622 2:152202104-152202126 AGCAAAAGATCAGTGGTTGTTGG - Intergenic
940390755 2:153130143-153130165 AGGGCAGGAGCTGTGATGGTGGG - Intergenic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
940955898 2:159726810-159726832 AGAGAAAGAAGATTGGTGGTTGG - Intronic
941063308 2:160872491-160872513 TGGGTAACAGCAGTGGAGGTAGG + Intergenic
941225139 2:162838817-162838839 AGGGAGGGAGCTGTGGGGGTGGG + Intergenic
941261935 2:163307900-163307922 AGGGAGAGAGCAATAGGGGTGGG - Intergenic
942046578 2:172102551-172102573 CGGGAAAGAGCAGAGGTGGCGGG + Exonic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
943096762 2:183438621-183438643 AGGGACAGAGCATAGGTGGGAGG - Intergenic
943718885 2:191182118-191182140 AGGCAATGAGATGTGGTGGTAGG + Intergenic
944414641 2:199469521-199469543 AAGAAAAGAAAAGTGGTGGTGGG + Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
945204278 2:207315141-207315163 AGGGAAGAAGCAGTGGGGGCTGG + Intergenic
946070382 2:217029769-217029791 AGGGGAAGAAAAGTGGTGGTGGG + Intergenic
947973471 2:234344208-234344230 GAGGAAAGGGCAGTGGAGGTGGG - Intergenic
948618376 2:239216431-239216453 AGGGCAAGATCAGGGCTGGTAGG - Intronic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
948996396 2:241582065-241582087 AGGGTAAGTGCAGTGGTGTGAGG + Intergenic
1168906125 20:1405182-1405204 AGAGAGAGTCCAGTGGTGGTGGG + Intergenic
1169654159 20:7903790-7903812 ATGGTGATAGCAGTGGTGGTGGG + Intronic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172244184 20:33434320-33434342 AGGGGAGGAGGAGTGGTGGAAGG - Intronic
1172427066 20:34862793-34862815 GGGTAAGGAGCAGTGGAGGTCGG - Exonic
1172646715 20:36474790-36474812 TTGGAAAGAGAAGTGGAGGTGGG - Intronic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173383092 20:42564033-42564055 AGGGAAGAAACAGTGGGGGTGGG + Intronic
1173439950 20:43067308-43067330 AGGGAATGGGGAGTGGGGGTTGG + Intronic
1173958869 20:47055966-47055988 ATGGAAGGAGCAGGGGTGGCGGG - Intronic
1174548077 20:51341597-51341619 GTAGAAAGAGCAGTGGGGGTTGG - Intergenic
1175102255 20:56587736-56587758 TGGGAAAGAGCAGGAGTGATTGG - Intergenic
1177058202 21:16335701-16335723 AGTGAAAGAGTACTGATGGTTGG - Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178153183 21:29819858-29819880 GGTGAAAGTGCAGTGGGGGTGGG - Intronic
1178170739 21:30036907-30036929 AGTGTAAGAACAGTGATGGTTGG - Intergenic
1179179286 21:39031616-39031638 GGGGACAGAACAGTGGAGGTAGG - Intergenic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179325079 21:40334507-40334529 AGGGGGAGAGCAGAGGAGGTTGG - Intronic
1179652382 21:42820035-42820057 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1181557225 22:23678067-23678089 AGGGAAACAGCAGAGGGGCTGGG - Intergenic
1181697155 22:24599493-24599515 AGGGAAACAGCAGAGGGGCTGGG + Intronic
1182557570 22:31137494-31137516 AGATAAAGAGGAGTGGTGGTGGG + Intronic
1183186399 22:36293898-36293920 GGGGCAGGAGCAGTGGGGGTGGG - Intronic
1183237255 22:36628770-36628792 AAGAAAAAAGCAGTGGGGGTTGG - Intronic
1183318692 22:37150724-37150746 ATGGGAAGGGCAGTGGGGGTTGG - Intronic
1183673292 22:39285526-39285548 AGGAAATGAGCAGGGGTGGGTGG - Intergenic
1184590758 22:45481388-45481410 AGACAAGGGGCAGTGGTGGTGGG - Intergenic
1184600640 22:45541355-45541377 AGGGAACGCGCTGTGTTGGTTGG + Exonic
1184604216 22:45562974-45562996 GGGGAAAGAGAGGTGGTAGTAGG - Intronic
1184668825 22:46002251-46002273 GGGGAAGGAGCAGTGGGGGGAGG + Intergenic
1185038820 22:48493920-48493942 AGTGAAAGAGCAGGGGTGGAAGG - Intronic
949686785 3:6583001-6583023 CTGGAAAGATCAGTGGTTGTGGG + Intergenic
949943573 3:9172999-9173021 AGGCAAACAGGAGAGGTGGTGGG + Intronic
950111879 3:10423886-10423908 GTGCAAAGGGCAGTGGTGGTGGG + Intronic
950202204 3:11052840-11052862 AGGGGAAGAGCAGTAGAGTTTGG - Intergenic
950202824 3:11056989-11057011 AGGCAAAGAGCTTGGGTGGTGGG - Intergenic
950311791 3:11965218-11965240 GGGAAAAGAGTACTGGTGGTGGG + Intergenic
950756022 3:15173373-15173395 GGGGAAAGAGCAGAGAAGGTGGG - Intergenic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
952045104 3:29309593-29309615 AGGGAATATGCAGTGGTGGGGGG + Intronic
952516664 3:34111512-34111534 AAGGAACGGGCAGTGGTGTTTGG + Intergenic
952688486 3:36176245-36176267 AGGAAAAGTGCAGTGATTGTGGG - Intergenic
953126502 3:40095887-40095909 AGGGAAGGTGCTGAGGTGGTAGG - Intronic
953872014 3:46635007-46635029 AGGGCAAGGGCAGTGGGGTTGGG - Intergenic
953911576 3:46895916-46895938 AGGGACAGTGCAATGGGGGTGGG - Intronic
954118002 3:48477944-48477966 ATGGAAAGAGCAGATGGGGTGGG - Intronic
954411869 3:50374364-50374386 AGGGGAAGGGGAGTGGAGGTGGG + Intronic
954558472 3:51536806-51536828 AGGAAAAGAGAAGTGGGGGGAGG + Intergenic
954747767 3:52796712-52796734 AGGGAAAGAGAGTTGGGGGTAGG - Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
955688150 3:61564552-61564574 AGGGAAAGGACAGTGGTGGGAGG + Intronic
956276535 3:67508028-67508050 AGAAACAGTGCAGTGGTGGTAGG + Intronic
957451657 3:80388524-80388546 ATGGAAAGAGGAGTGGTGGAAGG - Intergenic
958962048 3:100520311-100520333 AGGCAACGAGCACTGCTGGTTGG - Intronic
959040769 3:101420859-101420881 AGGGAAAGGGCAGAGCAGGTGGG + Intronic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960050176 3:113232101-113232123 AGGGAAGGAGCAGAGGGGGTGGG - Intronic
960995160 3:123335822-123335844 GGGGAAACAGCAGTGGTTGGGGG - Intronic
961204968 3:125074696-125074718 ATGGAATGAGCAGGGGTGGGAGG + Intergenic
961591142 3:127982758-127982780 AGGGAGAGAGCACTGGAGCTGGG - Intronic
961602986 3:128075505-128075527 GGGGAAGGAGCAGTGGGGGAAGG - Intronic
961803852 3:129474590-129474612 AGGGAAAGAGCATTCCTGGCTGG + Intronic
962249664 3:133828078-133828100 AGGGAAAGAGAAGGAGAGGTGGG + Exonic
962369458 3:134808797-134808819 AGGCAGATAGCAGTGGTGTTTGG + Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963459562 3:145591560-145591582 CTGGGAAGAGCAGTGGGGGTGGG + Intergenic
964373634 3:156028303-156028325 AAGGAAAGAAAAGTGGTGATAGG + Intergenic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
965925817 3:173978340-173978362 AGAGAAAGAGCAGTTTTGGAGGG + Intronic
966398213 3:179522990-179523012 AGGGAAAGAGGAGTGGTGAAAGG + Intergenic
967095200 3:186172297-186172319 AGGGGAAGTGGAGTGGGGGTGGG - Intronic
967973372 3:195015631-195015653 AGAGCAAGAGCTGAGGTGGTAGG - Intergenic
968339983 3:197947445-197947467 AAGGAAAGTGCAGTTGTAGTTGG - Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969306474 4:6328812-6328834 AGGGAGACAGTAGTGGTGATGGG + Intronic
969628761 4:8323071-8323093 AGGGATGGACCAGTGGTGGCTGG - Intergenic
969689230 4:8695010-8695032 AGGGAGAGGGCAGTGGAGGCGGG + Intergenic
969693539 4:8721799-8721821 TGGGAAAGAGCGGTGGAGATGGG - Intergenic
969728698 4:8940566-8940588 AGAGACAGAGCAGTGATGCTGGG - Intergenic
970914975 4:21321961-21321983 AGGGAAAGAGAAATGGTGGAAGG + Intronic
970963233 4:21897959-21897981 AGGGAAAGTGCAGTGATTATGGG + Intronic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
973304869 4:48635093-48635115 AGGGAAGAAGCAGAGGTGGAAGG + Intronic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975676248 4:76830766-76830788 AGGAAAGGAGCTGTGGTGGAAGG + Intergenic
975841595 4:78480232-78480254 ATGGGAAGAGTAGTGGGGGTGGG - Intronic
976226184 4:82797468-82797490 AGGGGAAGGGGAATGGTGGTCGG + Intronic
976566224 4:86553518-86553540 AGGGCAAAAGCAATGGTGGGAGG - Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977533238 4:98225036-98225058 CAGGGAAGTGCAGTGGTGGTGGG - Intergenic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
977888560 4:102280047-102280069 AGGGAAGGAGGAGTGGGGATCGG + Intronic
978270070 4:106878363-106878385 GGGGAAGGAGCAGTGGCAGTGGG - Intergenic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
981223307 4:142262290-142262312 AGGGGTAGAGGAGTAGTGGTTGG - Intronic
981522035 4:145672447-145672469 CGAGAAAGAGAAGTGGGGGTAGG - Intergenic
982745048 4:159097998-159098020 AGGGAAAGGGGAGTGGTGTGAGG + Intergenic
982797708 4:159665206-159665228 AGGGAAAGTGAGGTGGTGGGTGG + Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983168521 4:164509410-164509432 AGGGTGAGAGAAGGGGTGGTTGG - Intergenic
983319017 4:166171251-166171273 TGGGAAAGAGCAGTGATGTGGGG - Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984143809 4:176036660-176036682 AATGAAAGTCCAGTGGTGGTGGG - Intergenic
984423189 4:179551092-179551114 GGGGAAACAGCAGTGGTCCTGGG + Intergenic
984580943 4:181509455-181509477 AAGGAACGAGCAGTGTTGGAAGG - Intergenic
984886116 4:184451356-184451378 AGGGAGATAATAGTGGTGGTGGG + Intronic
984924603 4:184795640-184795662 TGGTAATGAGCAGTGGTGGTTGG - Intronic
985742546 5:1627083-1627105 AGGGGAAGAGGACTGGTGCTGGG - Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986738295 5:10683409-10683431 AGGAGATGAGCAGTGGTGCTGGG + Intronic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988494936 5:31736890-31736912 AGGGAAAGAGAATTGGGGGGAGG - Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989510432 5:42280612-42280634 AGGAAAAGAGCAGGGGCTGTTGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
990173160 5:53077934-53077956 AGGGGATGAGCAGTGAGGGTAGG - Intronic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
991410539 5:66341326-66341348 AGGGATGGTCCAGTGGTGGTAGG + Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993256985 5:85604471-85604493 AGGGAGGGAGCAGTGACGGTGGG + Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
994310750 5:98267706-98267728 AGGAAAAGTGCAGCGGTTGTGGG + Intergenic
994320334 5:98387314-98387336 AGGGGAAGTGCAGTGATTGTGGG - Intergenic
994750152 5:103727287-103727309 AGTCAAAGAGCAGTACTGGTGGG + Intergenic
994941199 5:106326548-106326570 AGGCAAAGAGCACTTGTGCTGGG + Intergenic
995125595 5:108574491-108574513 AGCGAAACAGCAGTGGTGGATGG + Intergenic
995443184 5:112214354-112214376 AATGAAAAAGCAGTGGTGGTGGG - Intronic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
997511211 5:134455862-134455884 AGAGAAAAAGAAGTGGTGGTTGG - Intergenic
997905223 5:137809603-137809625 AGGCAAACAGCAGTGATGGCTGG + Intergenic
997951133 5:138243421-138243443 AGGGAAAAAGAAGAGGTGGTGGG - Intergenic
998697343 5:144655301-144655323 ATGTAAAGAGTAGTAGTGGTAGG - Intergenic
998837634 5:146218352-146218374 AGGAAAAGAGAAGTGGTGAAAGG - Intronic
998873659 5:146577293-146577315 AGGGATGGAGCAGTGGGGCTGGG - Intergenic
999602031 5:153277503-153277525 AGGGAAGTATCAGTGTTGGTTGG + Intergenic
1001020031 5:168174912-168174934 TGGGAGAGAGCAGTGGTAGCTGG + Intronic
1001220150 5:169893638-169893660 AGGGAGAGAGCAGAAGTGGGTGG + Intronic
1001533256 5:172479699-172479721 GAGGGAGGAGCAGTGGTGGTGGG + Intergenic
1001958427 5:175864361-175864383 AGGGAAGGGGCAGGGGTGGCTGG - Intronic
1002047746 5:176551404-176551426 AGGGAAACAACAGTAGTGGCCGG + Intronic
1002168754 5:177363514-177363536 AAGGAAAGAGCACAGGTGTTGGG - Intronic
1002848043 6:966430-966452 AGGGAAAGAGACATGGTAGTGGG - Intergenic
1003260756 6:4513315-4513337 AGGGAAAGAGCATTCCTGGCAGG - Intergenic
1003635959 6:7831806-7831828 GGGGAAAGACCACTGGGGGTGGG + Intronic
1004158998 6:13196886-13196908 TGGAAAAGAGCAGAGGTGATTGG - Intronic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1006996237 6:38263990-38264012 AGGTAAAGAGCAGGGGTGGTGGG + Intronic
1007023947 6:38550699-38550721 AGGGTAGAAGCAGTGGAGGTAGG - Intronic
1007416324 6:41693602-41693624 CGGGAAGGCACAGTGGTGGTGGG - Intronic
1007910965 6:45513660-45513682 AGGGAAAGAAGAGGGGTGGAGGG + Intronic
1008086088 6:47245912-47245934 ATGGTCAGAGCAGTGGTGATAGG + Intronic
1008438179 6:51500852-51500874 GGGGGAAGAGTATTGGTGGTAGG + Intergenic
1008518013 6:52336481-52336503 AGAGAAAGAACAGTAGGGGTGGG - Intergenic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1008707585 6:54181735-54181757 AGGGAAAGACCAGTCCTGGCAGG - Intronic
1008970585 6:57362939-57362961 AGGGAAACCGGGGTGGTGGTGGG + Intronic
1009159554 6:60264764-60264786 AGGGAAACTGGGGTGGTGGTGGG + Intergenic
1009321664 6:62298099-62298121 AGAGAGAGAGCAGTGGTGGTGGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009744737 6:67798298-67798320 AGGGAAATTGGAGTGGTTGTGGG + Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1010088792 6:71953617-71953639 AGGGAAAGTACAGTGGTAATGGG - Intronic
1011688138 6:89840552-89840574 ATGGAAAGAGCATTGCTGGGGGG + Intronic
1012047724 6:94300403-94300425 AGGGAAAGTGCAGTTATTGTGGG + Intergenic
1012234885 6:96801868-96801890 GGGAAGAGAGCAGTGGTAGTTGG + Intronic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013337663 6:109181365-109181387 AAGGTAAGAAAAGTGGTGGTGGG - Intergenic
1013951429 6:115787116-115787138 GGAGAAAAAGCAGTGTTGGTTGG - Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014797000 6:125736959-125736981 TGGGAAAGAGCAATGAGGGTTGG - Intergenic
1014874003 6:126633351-126633373 AGGCAAAGAGTAGTGTTGCTTGG + Intergenic
1015569295 6:134604724-134604746 AGGGACAGAGCAGTGGCAGGTGG - Intergenic
1015571203 6:134623132-134623154 AGGGTAAGGGAGGTGGTGGTTGG - Intergenic
1015646358 6:135393242-135393264 AGGGAAAGAGCAGAGGGAATAGG - Intronic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1016691672 6:146944466-146944488 AGGAAAATAGCTGTGCTGGTTGG - Intergenic
1017912749 6:158808340-158808362 TGGGACAGTCCAGTGGTGGTGGG - Intronic
1018101888 6:160447387-160447409 AGGGAAACAGAAGTGCTGGAGGG - Intronic
1018133767 6:160757822-160757844 AGGGAAACAGAAGTGCTGGAGGG + Intergenic
1018632360 6:165832242-165832264 TGGGAGACAGAAGTGGTGGTGGG + Intronic
1018900740 6:168050569-168050591 GGGGAAAGAGCAGCGGTCGGAGG + Intergenic
1018998415 6:168727454-168727476 AGAGAGAGAGCAGAGGTGGCTGG + Intergenic
1019089576 6:169517171-169517193 AGAGAAAGAGAGTTGGTGGTGGG - Intronic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021402507 7:20225856-20225878 AGGGAAAGAGATGAGGTGCTAGG - Intergenic
1021595659 7:22313864-22313886 AGTAAAAGGGCTGTGGTGGTTGG - Intronic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022831213 7:34068530-34068552 AAGTACAGAGAAGTGGTGGTTGG + Intronic
1023095523 7:36656131-36656153 AAGGAAAGAGCAGATTTGGTTGG + Intronic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1023661834 7:42478260-42478282 AGAGAGAGTCCAGTGGTGGTGGG - Intergenic
1024156766 7:46633986-46634008 AGGCAATGAGCAGTGGAGGAAGG - Intergenic
1026977619 7:74508044-74508066 AGGGAGGAGGCAGTGGTGGTGGG - Intronic
1027288716 7:76678239-76678261 AGGGAATGAGCAGTGGCTGAGGG + Intergenic
1027434395 7:78149267-78149289 AAGGCATTAGCAGTGGTGGTAGG + Intronic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028041392 7:86058715-86058737 TGGCAAGGAGCAGTGGGGGTGGG + Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030561426 7:111091758-111091780 AGAGAAAAAGCAGTGTTGGGGGG + Intronic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031098460 7:117448770-117448792 AGGGAAGGACCAGTCCTGGTAGG + Intergenic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031272164 7:119665715-119665737 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032901957 7:136320483-136320505 TGGGATACAGCAGTAGTGGTGGG + Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034678132 7:152907012-152907034 AGGGGAAGAGGAGTGGTTGCTGG - Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035076605 7:156181855-156181877 AGGGGAAGAGCACTGGGCGTGGG - Intergenic
1035484161 7:159209346-159209368 TGAGACTGAGCAGTGGTGGTTGG + Intergenic
1036459733 8:8941242-8941264 AGGGAAGCAGCAGTGGCGGGCGG + Intergenic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1038046389 8:23768841-23768863 AGGGAAAGAGGGAAGGTGGTGGG - Intergenic
1038697164 8:29817062-29817084 AGGGAAAGAGGAGTGGGAGGAGG - Intergenic
1039133545 8:34294804-34294826 AGAGAGAGTCCAGTGGTGGTGGG - Intergenic
1039272389 8:35897292-35897314 AGGCAAAGAGCTGTGGTGCTTGG - Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1039698151 8:39934622-39934644 AATAAAAGAGCAGTGGAGGTGGG + Intronic
1039845257 8:41321420-41321442 AGGGGAAGGCCAGAGGTGGTCGG - Intergenic
1041090592 8:54297747-54297769 AGGGAAGCAGCAGAGCTGGTGGG - Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1042360924 8:67882344-67882366 AGGGGAAGAGCAGAGCTGGTGGG - Intergenic
1043314498 8:78903327-78903349 AGAGAAAGAGCAGAGGTTGAGGG - Intergenic
1043597234 8:81900599-81900621 ATGGAAAGAGGAGTGGTGAAAGG + Intergenic
1043603544 8:81971329-81971351 TGGCAAACAGCAGTGGGGGTGGG + Intergenic
1043804497 8:84654572-84654594 AGGGAAAGAGCAGTGGTGGTAGG - Intronic
1044291858 8:90481319-90481341 AGTGAAAGAGCATTTCTGGTAGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044565698 8:93659367-93659389 AGGGAAAGAAAAGCAGTGGTTGG - Intergenic
1045552345 8:103183690-103183712 AGGTATGGAGCAGAGGTGGTGGG - Intronic
1045622596 8:103998806-103998828 TTGGAAAGAGAAATGGTGGTAGG - Intronic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1047031985 8:120891906-120891928 AGGGAAAGTGAAATGGTTGTGGG - Intergenic
1048565180 8:135588576-135588598 AAGGAAAGAGGAGAGGTGGCTGG - Intronic
1049270198 8:141691491-141691513 AGGTAAGGGTCAGTGGTGGTTGG - Intergenic
1049443532 8:142619756-142619778 AAGGAAGGAGCAGTTGTGGGGGG - Intergenic
1049491281 8:142904457-142904479 TGGCAAAGAACAGTGGGGGTTGG - Intronic
1049792020 8:144476501-144476523 TGGGAATTAGCAGCGGTGGTTGG + Intergenic
1050124974 9:2347484-2347506 AGGGAAAGGGCAGAGGTTGGAGG - Intergenic
1050668593 9:7969731-7969753 AGGAAAAGAGCATAGGTGGTAGG + Intergenic
1050863757 9:10470800-10470822 AAGGAAACAGGAGTGGTGGAGGG + Intronic
1051597039 9:18834635-18834657 AGGGTGGGAGCAGTAGTGGTGGG - Intronic
1052223820 9:26059964-26059986 AGGTAAGGGGCAGGGGTGGTAGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1053420009 9:37971387-37971409 AGGGAAAGTGGAGAGGTGGGTGG - Intronic
1053946268 9:43312311-43312333 GGGGAAAAAGCCGTGGTGGCAGG - Intergenic
1055021717 9:71676992-71677014 AGTGGAAGAGCAGAGATGGTAGG + Intergenic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1056338483 9:85601245-85601267 AGGGCAGCAGCAGTGCTGGTGGG - Intronic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1056901349 9:90602902-90602924 AGGGACAGTCCGGTGGTGGTGGG + Intergenic
1057241226 9:93411776-93411798 AGAGAAAGTGCAGTGATTGTGGG - Intergenic
1057834354 9:98432299-98432321 AGAGAAAAAGGGGTGGTGGTTGG + Intronic
1058639249 9:107067145-107067167 AGGTGAAAGGCAGTGGTGGTGGG - Intergenic
1058943441 9:109835157-109835179 AGGGAAAGAGGAGAGGGTGTAGG + Intronic
1058943446 9:109835177-109835199 AGGGAAAGAGGAGAGGGTGTAGG + Intronic
1059476213 9:114550027-114550049 AGGAAAAGAACAATGTTGGTTGG - Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059652306 9:116326204-116326226 AGGCAAAGAGCAGGTGTGGTTGG - Intronic
1059671173 9:116493774-116493796 ATGGAAGGAGCAGTGGGAGTGGG + Intronic
1060304380 9:122397773-122397795 AGGGAGAGTGTAGTGGTTGTAGG + Intergenic
1060434285 9:123580487-123580509 AGGGTCAGAGCAGTGCAGGTGGG + Intronic
1060460745 9:123852133-123852155 TGGGGAAGAGTGGTGGTGGTAGG + Intronic
1060911799 9:127357138-127357160 AGGGAATGGGCAGTGGGGCTTGG + Intronic
1060954584 9:127629468-127629490 AGGGAGAGAGCAGCAGTGTTGGG + Intronic
1061477806 9:130880682-130880704 AAGGGAAGAGCAGTGGGGTTGGG - Intronic
1061509164 9:131049956-131049978 AGGGAAAGGGCAGAGCTGGTCGG - Intronic
1062221637 9:135419251-135419273 AGGGAGAGGGCAGTGGTGGGTGG - Intergenic
1203772679 EBV:57627-57649 GGAGAAAGAGTCGTGGTGGTGGG + Intergenic
1203589398 Un_KI270747v1:40869-40891 GGGGAAAAAGCCGTGGTGGCAGG - Intergenic
1186369034 X:8927717-8927739 AGGGAGACAGCAGTGGCGGGAGG - Intergenic
1186502679 X:10064727-10064749 AGAGATTGAGCAGTGGTGATTGG + Intronic
1187276809 X:17823548-17823570 AGGTCAAGAGCAGAGGTGGTGGG + Intronic
1187438991 X:19300192-19300214 AGGTTAAGAGCAGTGGTGTGGGG + Intergenic
1187770540 X:22690946-22690968 AGGTCAAGAGCAGTGGAGGATGG - Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1189171617 X:38914998-38915020 AGGGAAAAATTAGTGATGGTAGG + Intergenic
1189558160 X:42166260-42166282 GGGGAAACTGCAGTGGTGGGAGG + Intergenic
1189733371 X:44045223-44045245 AGGGAAAGAGGGGTGGGAGTGGG - Intergenic
1190154253 X:47974966-47974988 GGGGAAGGGGCAGTGGTGGCTGG - Exonic
1190469731 X:50766295-50766317 AGGGAAAAAGTAGTGGTGGCAGG - Intronic
1190708714 X:53050186-53050208 AAGGACAGTGAAGTGGTGGTGGG + Intronic
1190809483 X:53869549-53869571 AAGCAAAGAGGGGTGGTGGTGGG - Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1191887263 X:65901464-65901486 AGGCAAGTAGCAGTGGTGATGGG + Intergenic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192875348 X:75223645-75223667 AGGGAAACTGCAGTGATTGTGGG - Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1193328354 X:80207807-80207829 TGGCAAGGAGCAGTGGAGGTAGG + Intergenic
1193443972 X:81577346-81577368 TGGCAAGGAGCAGTGGGGGTAGG - Intergenic
1194336091 X:92647861-92647883 AGAGAAAAAGAAATGGTGGTGGG + Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196741883 X:119032245-119032267 AGAGGAAGAGAAGTGGTAGTTGG + Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1197777111 X:130125632-130125654 AGGGAAGGGGCAGTGGGGGAAGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198129577 X:133680266-133680288 AGGGATACAGCAGTTGGGGTTGG - Intronic
1198594855 X:138225071-138225093 AGGGAAAGAGCAGTGGGGTCAGG + Intergenic
1198708721 X:139478047-139478069 AGGGAAAGAGAAGAGGTGGAAGG + Intergenic
1198758514 X:140006258-140006280 AGGGAAAGTCCAGTGGTGGCGGG - Intergenic
1198780243 X:140227334-140227356 AGGGAAAGTCCAGTGGTGGCGGG + Intergenic
1199268360 X:145854358-145854380 AGGGAAAGAGCAGATGTGGGTGG - Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199767992 X:150954328-150954350 AGGGAACGTGGAGTGGTGGATGG - Intergenic
1200146639 X:153929790-153929812 AAGGAAAGAGCTTTGGAGGTGGG - Exonic
1200254068 X:154569970-154569992 AGGGAAAGGGCAGAGTTGGCAGG - Intergenic
1200263701 X:154634438-154634460 AGGGAAAGGGCAGAGTTGGCAGG + Intergenic
1200644523 Y:5764604-5764626 AGAGAAAAAGAAATGGTGGTGGG + Intergenic
1200813055 Y:7504377-7504399 ATGGAAAGAGGAGTGGTGAAAGG - Intergenic
1201234053 Y:11893195-11893217 ATGGAAAGAGGAGTGGTGACAGG + Intergenic