ID: 1043804504

View in Genome Browser
Species Human (GRCh38)
Location 8:84654609-84654631
Sequence TCCTTCTACTTTACATCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043804494_1043804504 22 Left 1043804494 8:84654564-84654586 CCCCACTTCCTACCACCACTGCT No data
Right 1043804504 8:84654609-84654631 TCCTTCTACTTTACATCTCCAGG No data
1043804498_1043804504 10 Left 1043804498 8:84654576-84654598 CCACCACTGCTCTTTCCCTGCCT No data
Right 1043804504 8:84654609-84654631 TCCTTCTACTTTACATCTCCAGG No data
1043804502_1043804504 -6 Left 1043804502 8:84654592-84654614 CCTGCCTCTGGTAACTATCCTTC No data
Right 1043804504 8:84654609-84654631 TCCTTCTACTTTACATCTCCAGG No data
1043804501_1043804504 -5 Left 1043804501 8:84654591-84654613 CCCTGCCTCTGGTAACTATCCTT No data
Right 1043804504 8:84654609-84654631 TCCTTCTACTTTACATCTCCAGG No data
1043804497_1043804504 14 Left 1043804497 8:84654572-84654594 CCTACCACCACTGCTCTTTCCCT No data
Right 1043804504 8:84654609-84654631 TCCTTCTACTTTACATCTCCAGG No data
1043804499_1043804504 7 Left 1043804499 8:84654579-84654601 CCACTGCTCTTTCCCTGCCTCTG No data
Right 1043804504 8:84654609-84654631 TCCTTCTACTTTACATCTCCAGG No data
1043804495_1043804504 21 Left 1043804495 8:84654565-84654587 CCCACTTCCTACCACCACTGCTC No data
Right 1043804504 8:84654609-84654631 TCCTTCTACTTTACATCTCCAGG No data
1043804503_1043804504 -10 Left 1043804503 8:84654596-84654618 CCTCTGGTAACTATCCTTCTACT No data
Right 1043804504 8:84654609-84654631 TCCTTCTACTTTACATCTCCAGG No data
1043804496_1043804504 20 Left 1043804496 8:84654566-84654588 CCACTTCCTACCACCACTGCTCT No data
Right 1043804504 8:84654609-84654631 TCCTTCTACTTTACATCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043804504 Original CRISPR TCCTTCTACTTTACATCTCC AGG Intronic