ID: 1043806977

View in Genome Browser
Species Human (GRCh38)
Location 8:84683845-84683867
Sequence CTTAATATACAGAATAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10230
Summary {0: 1, 1: 0, 2: 9, 3: 380, 4: 9840}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043806977_1043806981 30 Left 1043806977 8:84683845-84683867 CCCAGCTTATTCTGTATATTAAG 0: 1
1: 0
2: 9
3: 380
4: 9840
Right 1043806981 8:84683898-84683920 CTGATCTCGAACTCCCGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043806977 Original CRISPR CTTAATATACAGAATAAGCT GGG (reversed) Intronic
Too many off-targets to display for this crispr