ID: 1043806977 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:84683845-84683867 |
| Sequence | CTTAATATACAGAATAAGCT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 10230 | |||
| Summary | {0: 1, 1: 0, 2: 9, 3: 380, 4: 9840} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1043806977_1043806981 | 30 | Left | 1043806977 | 8:84683845-84683867 | CCCAGCTTATTCTGTATATTAAG | 0: 1 1: 0 2: 9 3: 380 4: 9840 |
||
| Right | 1043806981 | 8:84683898-84683920 | CTGATCTCGAACTCCCGATCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1043806977 | Original CRISPR | CTTAATATACAGAATAAGCT GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||