ID: 1043811537

View in Genome Browser
Species Human (GRCh38)
Location 8:84748479-84748501
Sequence CAGAATTAGGAAAATGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 448
Summary {0: 1, 1: 0, 2: 1, 3: 46, 4: 400}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043811537_1043811542 7 Left 1043811537 8:84748479-84748501 CCTGCCCCATTTTCCTAATTCTG 0: 1
1: 0
2: 1
3: 46
4: 400
Right 1043811542 8:84748509-84748531 TTGAGTTACTTAAAAAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043811537 Original CRISPR CAGAATTAGGAAAATGGGGC AGG (reversed) Intronic
900716610 1:4149027-4149049 TAAAACTGGGAAAATGGGGCTGG + Intergenic
902005580 1:13229418-13229440 CAAAATTATCAAAATGGGCCAGG + Intergenic
902024901 1:13375701-13375723 CAAAATTATCAAAATGGGCCAGG + Intergenic
902668043 1:17953164-17953186 TGGAATTAGGAAGATGGAGCTGG + Intergenic
902671087 1:17974328-17974350 GAAAATCAGGAAAATGGGACAGG + Intergenic
902858565 1:19227569-19227591 CAGAACTAGAAAAATGAGCCAGG + Intronic
903195923 1:21688187-21688209 TAGAATTGGGCAAATGAGGCTGG + Intronic
903864761 1:26389918-26389940 CAGAATGAGGAGGAAGGGGCAGG + Intergenic
904420278 1:30386689-30386711 CAGAACAAGGAAGATGGGGGAGG + Intergenic
904648660 1:31987660-31987682 CAGAATCAGGCATATGTGGCTGG - Intergenic
904664101 1:32106948-32106970 GAGAAATAGAAAAATAGGGCTGG - Intergenic
906610445 1:47198266-47198288 CAGGATCAGGAAAATGGTGGGGG + Intergenic
906748993 1:48242158-48242180 CAGACTGAGGCAAATGAGGCTGG - Intronic
906924794 1:50103794-50103816 TTGAATTAGCAAAATGGGGTGGG - Intronic
908625239 1:66032948-66032970 AAGAATTAGATAAATGAGGCCGG - Intronic
909158625 1:72115318-72115340 CAGATCTAAGAAAATGTGGCTGG + Intronic
909479635 1:76117544-76117566 CAGAATTATGAAAATGCAGTTGG - Intronic
911177741 1:94833715-94833737 CTGACTTAGGAAAATGGGGATGG + Intronic
911337320 1:96596370-96596392 CAGAAGTAGGAGAATGTGGCTGG - Intergenic
912451510 1:109770376-109770398 GAGAGCTAGGAAAATGGGGGCGG - Intronic
912542613 1:110428577-110428599 CTTAAATAAGAAAATGGGGCTGG - Intergenic
913236016 1:116784151-116784173 CTGAAGTATGAAAATGGGGCTGG + Intergenic
913451575 1:118996394-118996416 CAGCAAAAGGATAATGGGGCAGG + Intergenic
914724092 1:150312887-150312909 TAAAATAAGGATAATGGGGCCGG + Intergenic
915332835 1:155124424-155124446 CAGAAGTTGGAAAATAGGCCGGG - Intergenic
915414531 1:155730819-155730841 CAGAAGCATCAAAATGGGGCTGG + Intronic
915585892 1:156843745-156843767 CTGCAAGAGGAAAATGGGGCTGG - Intronic
916818746 1:168377979-168378001 CAGAATGGGGACAATGTGGCTGG + Intergenic
920766552 1:208839178-208839200 CATCATTAGGAAGATGGGGAAGG + Intergenic
921590646 1:216999145-216999167 CAGATTCAGGTAATTGGGGCTGG - Intronic
922596307 1:226816113-226816135 CAGAGGAAGGAAGATGGGGCAGG - Intergenic
924607668 1:245549036-245549058 CAAAAGTTGCAAAATGGGGCAGG - Intronic
1063126742 10:3142608-3142630 CAGAGTTCGGAAGAAGGGGCTGG + Intronic
1063711730 10:8485705-8485727 CAGAATGAGGAAATTAGGGAAGG - Intergenic
1063862210 10:10323362-10323384 CAGAATTAGGAATCTGGGTTTGG - Intergenic
1064151023 10:12864970-12864992 AGAAATTAGGAAAATGCGGCCGG - Intergenic
1064214309 10:13386806-13386828 CAGAAATGAGAAAATTGGGCCGG + Intergenic
1064281441 10:13955089-13955111 CAGAATTATTAACATGGGGTTGG - Intronic
1066566001 10:36722919-36722941 AACAATTAAGAACATGGGGCCGG + Intergenic
1066746459 10:38606486-38606508 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1067278322 10:44853405-44853427 CAAAGCTGGGAAAATGGGGCTGG - Intergenic
1067313724 10:45141182-45141204 AAGAATCAGGAAAATCGGGTCGG - Intergenic
1068193299 10:53682637-53682659 CAGAATTAGGAAACAAGGGACGG + Intergenic
1068450718 10:57183623-57183645 CAGATTAAAGAAAATGGGGTGGG + Intergenic
1069523895 10:69150350-69150372 CAAAATCAGGAAAGTTGGGCCGG - Intronic
1069882270 10:71601124-71601146 CAACATTAGGAAACTGGGCCTGG + Intronic
1070456075 10:76618929-76618951 CAGAAATAGGAAAATGGCAAAGG + Intergenic
1070835865 10:79446480-79446502 CAGAAATAGGAGAAGGGGGGGGG - Intergenic
1070991644 10:80738705-80738727 GAGAAAAAGGAAAAAGGGGCGGG - Intergenic
1072164654 10:92801654-92801676 CAGAATGGGGAAAATGGGAAAGG - Intergenic
1073158663 10:101370407-101370429 CAGGATAAGGAAGAAGGGGCGGG - Intronic
1074163872 10:110857976-110857998 GAGAATGAGGCACATGGGGCAGG - Intergenic
1074246757 10:111702004-111702026 CAGAATATGATAAATGGGGCCGG - Intergenic
1075036601 10:119074635-119074657 AAAAAATAGAAAAATGGGGCCGG + Intronic
1075524770 10:123174680-123174702 TTGACTTAGGAAAATGTGGCTGG + Intergenic
1076029924 10:127148659-127148681 AAGAATTACCAAAATAGGGCTGG + Intronic
1076706562 10:132305261-132305283 CCAAATTAGGAAAATGGTTCTGG + Intronic
1078294638 11:10055765-10055787 CAGAAGTGGGGAAATGGGGAAGG + Intronic
1081003947 11:37710273-37710295 CAGAACTAGCAAAAAGGGGGAGG + Intergenic
1081397092 11:42599070-42599092 CATTATCAGGATAATGGGGCAGG + Intergenic
1081517705 11:43849448-43849470 CAGAAGTAGGAAGGTGGGGAGGG - Intronic
1081799760 11:45849918-45849940 CAGAACTGGGAGAAAGGGGCTGG - Intronic
1082040513 11:47681031-47681053 CAGTAAAAGGAAAATGAGGCTGG + Intronic
1083480481 11:62941976-62941998 GATAGTAAGGAAAATGGGGCCGG - Intronic
1083498838 11:63084275-63084297 CAGAATTGAGATAAAGGGGCTGG + Intronic
1083578494 11:63809858-63809880 AAGAATTAGGGAAATGGAACTGG + Intergenic
1084346634 11:68555208-68555230 AAGAATTACTAAAATGGGACAGG - Intronic
1086597914 11:88596091-88596113 CAGGAATAGAAAAATGGGGATGG - Intronic
1087460572 11:98440373-98440395 AAGAAATAGGTAAATGAGGCTGG - Intergenic
1088063569 11:105687666-105687688 CAGAATTATGACGATGGGTCAGG + Intronic
1088345505 11:108819894-108819916 CAGAAATAGGCGTATGGGGCTGG - Intronic
1089126264 11:116178633-116178655 CAGAGTGAGGAAGATGGGGAAGG - Intergenic
1089543430 11:119205181-119205203 CAGAATTAGTAAATTAGGGCAGG + Intergenic
1090137858 11:124217930-124217952 CAGGGTTGGGAAAATGGGGAGGG - Intergenic
1090174223 11:124633437-124633459 CAGAAGTAGAAGAATGGGGATGG + Exonic
1090428917 11:126629692-126629714 CGGAAATAGGAAAATGAGGTTGG + Intronic
1091843181 12:3634902-3634924 ATGAATAAAGAAAATGGGGCAGG - Intronic
1092170928 12:6373776-6373798 CAGAACAAGGAGAATGGGTCAGG - Intronic
1092553697 12:9531931-9531953 CAGAATAAGGATACTGGGGAAGG - Intergenic
1092614392 12:10203187-10203209 GAGAGATAGGAAAAGGGGGCAGG - Intergenic
1092800995 12:12166799-12166821 ATGAATTAGGAAAATGAGGCTGG + Intronic
1093033087 12:14307001-14307023 CATAATTAAGAAAATGAGGCCGG - Intergenic
1093041862 12:14389918-14389940 AACAATTAGAGAAATGGGGCTGG - Intronic
1094482868 12:30898780-30898802 CAAAATTAGGATTATGGGGCGGG + Intergenic
1094518402 12:31158692-31158714 CAGAATAAGGATACTGGGGAAGG + Intergenic
1097081838 12:56437514-56437536 CAGAATACAGAAAATGAGGCAGG + Intronic
1097484803 12:60182715-60182737 CAGGTCTAGGAAAATGGGACAGG + Intergenic
1098535686 12:71591589-71591611 CAGAATTTAGACAATTGGGCTGG - Intergenic
1099970150 12:89491716-89491738 AACAAGTAGGAAAATGGAGCAGG - Intronic
1101711497 12:107271202-107271224 TAGAATTAGGAGAGTGGGGAGGG - Intergenic
1102169262 12:110829578-110829600 TGGAAATAGGAAATTGGGGCGGG + Intergenic
1102321422 12:111938669-111938691 CAGGATTAGTATAATAGGGCAGG + Intronic
1102555093 12:113721675-113721697 TATAATTATGAATATGGGGCCGG - Intergenic
1104176447 12:126337390-126337412 TAAAATTAGAAAGATGGGGCTGG - Intergenic
1104801815 12:131559659-131559681 CCGAGTTATGATAATGGGGCGGG - Intergenic
1105925892 13:25007627-25007649 CTGGATTAAGAAAATGTGGCAGG - Intergenic
1106142025 13:27019596-27019618 CAGAATTTGGGGAATGGGACAGG - Intergenic
1106207987 13:27617252-27617274 TAGAATTAGAAGACTGGGGCAGG - Intronic
1106418599 13:29567193-29567215 CAGAATAATAAAAATGGGGCAGG + Intronic
1106555424 13:30804475-30804497 GGGAATGAGGAAGATGGGGCTGG + Intergenic
1106717466 13:32406211-32406233 CAGAACCATAAAAATGGGGCAGG - Intronic
1107918314 13:45175916-45175938 TAGAATTTGGCAAATGGGCCAGG - Intronic
1107945479 13:45414320-45414342 CCAAATAAGGAAAAGGGGGCGGG + Intronic
1108134022 13:47335459-47335481 AAGAAATAGGAAAAGGGGGCCGG - Intergenic
1109302670 13:60605265-60605287 AAGAAGTAGGAAAGTGGGCCAGG + Intergenic
1109535010 13:63704896-63704918 CAGATTTGGCAAATTGGGGCAGG - Intergenic
1109773103 13:67003078-67003100 GAGACTGAGGAAAATGGGTCTGG - Intronic
1110714405 13:78684652-78684674 CAGAATAAAGAAAATCAGGCTGG - Intergenic
1112230078 13:97580968-97580990 CAAAACTAGGATAATGAGGCCGG - Intergenic
1113044505 13:106140907-106140929 CTAAATTAGAAAATTGGGGCTGG + Intergenic
1114286496 14:21249273-21249295 CAGAATCAAGGAATTGGGGCTGG + Intronic
1115596683 14:34916411-34916433 AAGAATTAGCAAAGTGGGCCGGG - Intergenic
1116443467 14:44980971-44980993 CAGGATTAGGAAAAAAGGGATGG + Intronic
1116558448 14:46344327-46344349 CAGATTTAGGAAAATGGAGTGGG - Intergenic
1118041214 14:61919215-61919237 CTGTCTTAGGAAAATGGGACAGG - Intergenic
1118486634 14:66220492-66220514 CAGAAATACAAAAATGAGGCTGG - Intergenic
1119331931 14:73801306-73801328 CAGAATTGGGAGAATAGGGGAGG - Intergenic
1119997475 14:79269343-79269365 CAAAATAAGAAAAATAGGGCCGG - Intronic
1120583803 14:86287011-86287033 GAGAATTAAGAAAAAGGGGAGGG + Intergenic
1120669071 14:87343091-87343113 CTATATTAGGAAAATGGGGCCGG + Intergenic
1120860127 14:89247494-89247516 CAGAATTATGATAAGGGGACAGG + Intronic
1121121210 14:91376892-91376914 CAGACCTGGGAAAGTGGGGCTGG + Intronic
1121494364 14:94381725-94381747 CAGAAGGAGGAGACTGGGGCTGG + Intronic
1121685623 14:95832956-95832978 CAGAATTAGAGAATTGGGGGGGG - Intergenic
1122251989 14:100446256-100446278 CAGAATTAGTAAAAATGGGCTGG + Intronic
1125287282 15:38107319-38107341 AAGGCTTAGGATAATGGGGCAGG - Intergenic
1127890217 15:63243684-63243706 CAGAATTTGGGGAAGGGGGCAGG + Intronic
1128649742 15:69401782-69401804 CAGAGTTAGGAAGATTGAGCAGG - Intronic
1129596604 15:76969329-76969351 AAGGGCTAGGAAAATGGGGCTGG - Intergenic
1129712386 15:77826960-77826982 CAGAGTTTGGAAAGGGGGGCAGG - Intergenic
1129992030 15:79973787-79973809 CAGAAGGAGGAAGATGGGGTAGG - Intergenic
1130686181 15:86039847-86039869 CAGAATTCTGAAGATGGGCCAGG - Intergenic
1132136804 15:99349838-99349860 CATAAGTAGAAAAATGCGGCCGG + Intronic
1133085774 16:3361968-3361990 CAAAATTAGAAAAATGGGCCAGG + Intergenic
1133371462 16:5248691-5248713 CAGAGTTAGGACAAGAGGGCCGG + Intergenic
1134012691 16:10866947-10866969 CAAAATGAGAGAAATGGGGCCGG + Intergenic
1134509817 16:14836999-14837021 TAAAATAAGTAAAATGGGGCCGG - Intronic
1135464886 16:22676702-22676724 CTGAATTAGAAAAATCAGGCAGG + Intergenic
1136736602 16:32473156-32473178 CAGGGGAAGGAAAATGGGGCAGG - Intergenic
1138367237 16:56490359-56490381 AAGTATTAAGAAAATGTGGCTGG + Intronic
1139256336 16:65546533-65546555 CAGAATTAAGAGATGGGGGCAGG - Intergenic
1139398154 16:66657385-66657407 CAAAATCAGGAAATTAGGGCTGG - Intronic
1140422335 16:74830860-74830882 CAGAAGCAGGCACATGGGGCAGG + Intergenic
1141030884 16:80587290-80587312 CAGAAGTAGGAACATGGGAAGGG + Intergenic
1203016466 16_KI270728v1_random:356421-356443 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1203034801 16_KI270728v1_random:629579-629601 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1143682919 17:8491059-8491081 GAGAATGAGGGAAATGGTGCTGG - Intronic
1144087000 17:11818985-11819007 CTGAATTAGGAAGTAGGGGCGGG - Intronic
1144220383 17:13094630-13094652 CAGTATCAGGAAAGTGGGGCAGG - Intergenic
1144660450 17:17064587-17064609 CAGATTTATGGAAATGGAGCAGG - Intronic
1146012649 17:29208039-29208061 GAGAACTTTGAAAATGGGGCAGG + Intergenic
1146435990 17:32848323-32848345 AAGAATTAGGGGAAAGGGGCAGG + Intronic
1146973520 17:37091990-37092012 TAAAATTATGAAAATGGGCCTGG + Intronic
1147326370 17:39671653-39671675 CAGAGGAAGGAAAATGGGGATGG - Exonic
1147757037 17:42775561-42775583 CAGACTGAGCAAAATGGGGAGGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148719345 17:49739695-49739717 CAGATTTAGGAAATAGGGGAGGG + Intronic
1149397348 17:56258523-56258545 CAGAATTTGGAATAAGGGGCTGG + Intronic
1149681663 17:58511923-58511945 CAGAGCTAGGAAAATGAGGCAGG + Intronic
1152478787 17:80536423-80536445 AAGAAAAAGAAAAATGGGGCCGG - Intergenic
1152633064 17:81419390-81419412 CGGAATGAGGAATGTGGGGCAGG + Intronic
1153035841 18:761641-761663 CTGGATTAAGAAAATGAGGCTGG - Intronic
1153132275 18:1868869-1868891 CAAGATTAGGAGAATTGGGCTGG + Intergenic
1153142910 18:1995292-1995314 AAGAACTTGGCAAATGGGGCAGG - Intergenic
1153164088 18:2242097-2242119 AAAAATTAGTAAAATGGGGCTGG - Intergenic
1153297339 18:3560123-3560145 AAGAATGAGAAAAATGGGCCAGG + Intronic
1153893207 18:9536964-9536986 CAGAAACAAGAAAATGGGGTGGG - Exonic
1159137228 18:64350464-64350486 CAGAAATATGAAATAGGGGCTGG - Intergenic
1159200046 18:65172056-65172078 CTGGATTAAGAAAATGTGGCAGG + Intergenic
1159743002 18:72196504-72196526 CTGAATAAGGAAAAGGGGGAGGG + Intergenic
1160216566 18:76938090-76938112 CAGAATTAGAAAGCTGAGGCTGG + Intronic
1160759994 19:779010-779032 CAGACTCAGAAAACTGGGGCAGG + Intergenic
1161270307 19:3386000-3386022 CAGAATGAGGAGGATGGGCCGGG - Intronic
1161385284 19:3988568-3988590 CAGATTTGGGAAAACGGGCCGGG + Intergenic
1161394090 19:4035485-4035507 CTGCATTTGTAAAATGGGGCTGG + Intronic
1161491773 19:4566330-4566352 CAAAATAAGTAAAATGGAGCAGG - Intergenic
1162107416 19:8378429-8378451 CTGCATTTGGAAAATGGGGATGG + Intronic
1162732191 19:12725072-12725094 AAGAAATAGGAAAACTGGGCCGG - Intergenic
1163407721 19:17133747-17133769 AAGAAGTAGGAAAGTAGGGCTGG - Intronic
1163580705 19:18137115-18137137 CAGAACCAGAAAAATGGGCCGGG - Intronic
1164039851 19:21484543-21484565 CAGAAACAGGAGGATGGGGCCGG - Intronic
1164053813 19:21605482-21605504 AAGAATAAGGAGAATGGGCCGGG + Intergenic
1164073197 19:21788280-21788302 CACAATTAGGACAATTGGGCTGG + Intergenic
1164564874 19:29318624-29318646 AAGCATTGGGAAAATCGGGCGGG - Intergenic
1165337672 19:35183286-35183308 CAAAATCAGGAAAACAGGGCTGG + Intergenic
1166191474 19:41179707-41179729 AAGAATAAAAAAAATGGGGCCGG + Intergenic
1166431880 19:42734846-42734868 CAGAGTTAGGAAAAATGGGGAGG + Intronic
1166434996 19:42760063-42760085 CAGAGTTAGGAAAAATGGGGAGG + Intronic
1166447842 19:42873826-42873848 CAGAGTTAGGAAAAATGGGGAGG + Intronic
1166470721 19:43077409-43077431 CAGAGTTAGGAAAAATGGGGAGG + Intronic
1166481834 19:43180939-43180961 CAGAGTTAGGAAAAATGGGGAGG + Intronic
1166484305 19:43200057-43200079 CAGAGTTAGGAAAAATGGGGAGG + Intronic
1166491425 19:43263935-43263957 CAGAATTAGGAAAAATGGGGAGG + Intronic
1167437163 19:49486158-49486180 CAGAGTTGGGTAAATGGGGCCGG - Exonic
925437633 2:3854281-3854303 CAGAATTAAAAATATGTGGCAGG - Intergenic
925629291 2:5872815-5872837 CAGAAATAAGAAGATGGGGTAGG - Intergenic
926549674 2:14286717-14286739 CTGTATTTGGAAAATGGGGATGG - Intergenic
927277061 2:21271382-21271404 CTGAACTAGGTACATGGGGCTGG - Intergenic
927557602 2:24047171-24047193 GAGGATGAGGAGAATGGGGCGGG - Intronic
928203164 2:29264315-29264337 CAGAATCAGGAAAATGCTACTGG - Intronic
929975349 2:46628404-46628426 CAGAATTAGAAAAATCCTGCCGG - Intergenic
930044137 2:47154382-47154404 CAGAATAAGGAAAATGAGATGGG + Intronic
930636317 2:53809757-53809779 AATAATTAAGAAAATGAGGCCGG + Intronic
930636936 2:53816564-53816586 CATTAATAAGAAAATGGGGCTGG - Intronic
930801529 2:55447857-55447879 CTGGATTAAGAAAATGTGGCTGG + Intergenic
931230538 2:60370997-60371019 CAGAATTGGGAAGCTGGGGCTGG + Intergenic
933359304 2:81258629-81258651 CAAAATTCTGAAGATGGGGCTGG + Intergenic
933752938 2:85614883-85614905 GAGGGTTAGGAAAATGAGGCTGG - Intronic
933972678 2:87483071-87483093 TACAATTAGGAATTTGGGGCAGG + Intergenic
934187756 2:89762273-89762295 CAGGGGAAGGAAAATGGGGCAGG - Intergenic
934308861 2:91845675-91845697 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
934931183 2:98425456-98425478 CAAAATGAGTAAAATGGGGCAGG + Intergenic
934999335 2:98997387-98997409 GAGATTTAGGAAATTGGGGGAGG + Exonic
935150267 2:100427650-100427672 CAGAAACAAGAAAATGGGACGGG - Intergenic
935277865 2:101491364-101491386 TAGAAATAGGAACAGGGGGCTGG + Intergenic
935295783 2:101648116-101648138 TAGAATTAGGAAAATAAGGATGG - Intergenic
936127018 2:109796935-109796957 CAGAATGTCTAAAATGGGGCCGG - Intronic
936217679 2:110574551-110574573 CAGAATGTCTAAAATGGGGCCGG + Intronic
936321040 2:111467142-111467164 TACAATTAGGAATTTGGGGCAGG - Intergenic
936370804 2:111900409-111900431 CAGATTATGAAAAATGGGGCTGG - Intronic
936426823 2:112429122-112429144 CAGAATGTCTAAAATGGGGCCGG + Intronic
936754304 2:115687273-115687295 CAGAATAAAGAATATGGGGGAGG - Intronic
936847214 2:116851759-116851781 CAGAAAGAGGAAAATGGGGAAGG - Intergenic
937826783 2:126375075-126375097 CTGAATAAAGAAAATGGGGCTGG - Intergenic
938198447 2:129353209-129353231 CAATTCTAGGAAAATGGGGCAGG - Intergenic
938212946 2:129483848-129483870 CAGAAAGAGGAAAATGGGGGAGG - Intergenic
938226905 2:129624415-129624437 CAGACCTAGGAAAACTGGGCTGG - Intergenic
938472330 2:131576073-131576095 CAGAATTAGGCAGATGCTGCCGG - Intergenic
939056398 2:137370091-137370113 CAAAAGTAGGAAAATTGGACAGG + Intronic
939815405 2:146890152-146890174 CATAATTTGGGAAATGGGGTTGG - Intergenic
940135014 2:150425797-150425819 CAGAGGAAGGAAACTGGGGCAGG - Intergenic
940917828 2:159276722-159276744 CACAATTAAGAAATTGAGGCTGG + Intronic
941792042 2:169562936-169562958 CACACGTAGGAAAATGTGGCAGG + Intronic
944567064 2:201002135-201002157 CTCAATAAGAAAAATGGGGCTGG + Intronic
945359455 2:208879569-208879591 TAGAGTTGGGAAGATGGGGCTGG - Intergenic
946227828 2:218273791-218273813 CAAAATGAGGAAACTGGGCCTGG - Intronic
947361008 2:229345415-229345437 GAGAATAGGGAAAATGAGGCAGG - Intergenic
948090392 2:235288734-235288756 CAGAATTAGGAGATTGGGGCCGG - Intergenic
948197726 2:236107721-236107743 CAGAATCAGGAAAACCTGGCTGG + Intronic
948347484 2:237311084-237311106 CATTATTAGGGAAGTGGGGCGGG + Intergenic
1170154748 20:13258985-13259007 CATAATTAGGAATCTGGGCCGGG + Intronic
1170533446 20:17316721-17316743 CAGTATCAGAAACATGGGGCTGG - Intronic
1170623732 20:18015022-18015044 CAGAATGAGCAAAATCAGGCCGG + Intronic
1170777168 20:19385928-19385950 CAGAAATAGAAAAATAGGCCAGG - Intronic
1170989415 20:21288195-21288217 AAAAAATAGAAAAATGGGGCTGG + Intergenic
1171478945 20:25437820-25437842 CAGAATAAGAGAAAAGGGGCCGG + Intronic
1172036118 20:32011824-32011846 AAGAATGAGGCAGATGGGGCTGG + Intronic
1172460366 20:35113776-35113798 CAAAATTAGGAAAATTAGCCAGG + Intergenic
1172589246 20:36105891-36105913 CAGAATAGGGAAAAGGTGGCAGG - Intronic
1172665268 20:36594832-36594854 AAAAATTAAGAAATTGGGGCTGG - Intronic
1172754525 20:37273907-37273929 CAGAATTAGAAAAAGAGGCCAGG + Intergenic
1173168638 20:40704419-40704441 CAGCATCTGGAAAATGGGCCTGG + Intergenic
1174293083 20:49522727-49522749 CAGATTAAAGAAAATGGGTCGGG + Intronic
1175346631 20:58283418-58283440 GACAATTAGGAAAATGAAGCTGG + Intergenic
1175716924 20:61261159-61261181 CTGACTTAGGAATCTGGGGCAGG - Intronic
1177060110 21:16361851-16361873 TAGAATTAAGAATATGAGGCCGG - Intergenic
1177597134 21:23259107-23259129 CAAAATCAGCAAAATGAGGCAGG + Intergenic
1178195428 21:30339495-30339517 TAGATTTAGAAAAATAGGGCCGG - Intergenic
1178573626 21:33764390-33764412 CAGAATAAGGAAGAGCGGGCAGG + Intronic
1178996485 21:37405341-37405363 AAGAATTAGGAAAAGGATGCAGG - Intronic
1180535944 22:16392763-16392785 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1181371174 22:22418139-22418161 TAGAATGAGTAAAATGCGGCTGG + Intergenic
1181767952 22:25105315-25105337 CAGAAATCAGAAAATGGGCCAGG - Intronic
1182938252 22:34247564-34247586 AAGAAATAGGAAAAAGGGCCGGG - Intergenic
1183480572 22:38062542-38062564 CAGACTGAAGAAAATGGGGCCGG - Intronic
1183608843 22:38883892-38883914 CAGAACTGGCAGAATGGGGCTGG - Intergenic
1184206851 22:43010162-43010184 TAGAAATAATAAAATGGGGCTGG - Intronic
1185309981 22:50148962-50148984 CACCATTAAGAAAATGGGGTTGG - Intronic
949479916 3:4483965-4483987 CAGAAAAAGCAAAATGGGCCTGG - Intergenic
951220368 3:20062755-20062777 AATAATTATGAAAATGGGCCAGG - Intronic
952130157 3:30352774-30352796 CAGAAAGAGGAAAATGAGACAGG + Intergenic
952223324 3:31347276-31347298 CAGAATCATGAAAATGGGAATGG - Intergenic
952248467 3:31624481-31624503 CAGAATTAGAAACCTGGGGCTGG + Intronic
952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG + Intronic
952617187 3:35288412-35288434 CAGAAGTAGGTAAATGGAGCAGG - Intergenic
952812043 3:37412669-37412691 CAGAATAAGAAAAATAGGCCAGG + Intronic
952877324 3:37957367-37957389 GAGAATTAGGTTAATGGAGCTGG - Intronic
953225085 3:41011146-41011168 CAGAACTAGGAACATTGGACCGG - Intergenic
953497379 3:43399899-43399921 CAAAATGAGGAAAATTGGGGTGG - Intronic
954006294 3:47593866-47593888 GAGAATTAGGAATAAGGGGCTGG + Intronic
954044864 3:47920859-47920881 AAGAAGTAGAAAAATGTGGCTGG + Intronic
954520845 3:51224945-51224967 CAGAGTTGGGCAAATTGGGCTGG + Intronic
955200328 3:56846290-56846312 TAGAAATTAGAAAATGGGGCAGG + Intronic
955333975 3:58069960-58069982 AAGTATTAGGAAAATGAGGATGG + Intronic
955718529 3:61857052-61857074 CAGAAATAGGAAAATAGGATGGG - Intronic
956249018 3:67216042-67216064 CAGTATTCTGAAAATGGAGCAGG - Intergenic
956254605 3:67270650-67270672 CAGAGTTAAGAAAAAGGGGCTGG - Intergenic
956494161 3:69806379-69806401 AAAAATTAGTAAAATGGGCCGGG - Intronic
957595401 3:82258896-82258918 CTGGATTAAGAAAATGTGGCAGG + Intergenic
957744779 3:84325349-84325371 CAGAAATAGGAAAATGATACAGG + Intergenic
958652108 3:96949884-96949906 GTCAATTAGGAAAATGGTGCTGG - Intronic
959362444 3:105410251-105410273 CAGAATTAGCACAATGGGAAAGG + Intronic
959713043 3:109403863-109403885 CACAATTAGGAAAATTAGCCAGG - Intergenic
959755800 3:109897515-109897537 AAGAATTAGGGAAATGAAGCAGG - Intergenic
961921605 3:130432256-130432278 AAAAATGAGGAAACTGGGGCTGG + Intronic
961958412 3:130828060-130828082 CAAAATAAGGAAGATGGTGCTGG + Intergenic
962420756 3:135226613-135226635 CAAAAGTAGGTGAATGGGGCTGG - Intronic
963312050 3:143720412-143720434 CAGAACTAGGACTATGAGGCTGG + Intronic
963358826 3:144244666-144244688 CTGAATTGGGACAATGGGACTGG + Intergenic
964413501 3:156423812-156423834 CAGAGTCAGGAAAATGAGCCAGG + Intronic
964728482 3:159839930-159839952 CAGGCTTAGGAACATGGAGCTGG - Exonic
967331856 3:188298146-188298168 CACAATTGGGAAATTTGGGCAGG - Intronic
968261525 3:197328667-197328689 TCGAATTAGGAGAATGGAGCAGG + Intergenic
969165741 4:5309867-5309889 CAAAAATAGAAAAATGGGGCTGG + Intronic
969798051 4:9541222-9541244 CAGAGTTAGGACAAGAGGGCTGG + Intergenic
969909796 4:10433319-10433341 CAGAACAAGGAAGATAGGGCAGG - Intergenic
970833584 4:20372013-20372035 CAGAATGATGAAAATAGTGCTGG - Intronic
972170680 4:36342070-36342092 CAAAATTAAGAAACTGGGGTCGG + Intronic
972260589 4:37404567-37404589 CAGAAAGAGGGATATGGGGCAGG - Intronic
972993953 4:44856273-44856295 CAGAATGAAGAAAAATGGGCAGG + Intergenic
973905088 4:55520736-55520758 CAGAATTGGGAAAATTGTGAAGG - Intronic
975197549 4:71543153-71543175 AAGAATTAGCTAAATGAGGCTGG + Intronic
976402667 4:84624789-84624811 AAGAATTACTAAAAAGGGGCTGG - Intronic
976830067 4:89305722-89305744 CATAATTAAGAAAATGTTGCAGG + Intronic
977743344 4:100514270-100514292 CAGAAATAGGAAAATGGCTTGGG - Intronic
978311403 4:107388126-107388148 GAGAAAAAGGAAAATGGGGTTGG - Intergenic
979098930 4:116590040-116590062 AAGAATTGGTAAAATGGGCCAGG - Intergenic
980557256 4:134425175-134425197 CATAATTAAGTAAAAGGGGCTGG + Intergenic
980909243 4:138978800-138978822 GAGGACTAGGAAAATGAGGCTGG + Intergenic
981216624 4:142177084-142177106 CTGAATTAGGAGAAAGAGGCAGG - Intronic
982362129 4:154530347-154530369 CAGCATTAGGATAATGTAGCAGG - Intergenic
982464265 4:155710695-155710717 AAGAAGCAGGAAAAAGGGGCAGG + Exonic
983195937 4:164806735-164806757 CATATTTACAAAAATGGGGCCGG - Intergenic
983541572 4:168916963-168916985 TAGAATTAGAAAATGGGGGCGGG - Intronic
990159430 5:52921274-52921296 CAGAAGTAGGAAAATTGGCCTGG - Intronic
991669965 5:69037800-69037822 GAGAAAAAGGAAAATGAGGCTGG + Intergenic
993236514 5:85317214-85317236 TATAATTAGGAAAATGGTGAGGG - Intergenic
993263214 5:85688446-85688468 CAGAGAGAGTAAAATGGGGCTGG - Intergenic
994088673 5:95788207-95788229 CAGAATGAGGAGAATGGAGCTGG + Intronic
994727274 5:103451455-103451477 CAGGACTAGAAAAATGGAGCTGG - Intergenic
995630109 5:114123657-114123679 AAAAATTAAGAAAATGAGGCCGG - Intergenic
996737608 5:126772409-126772431 TAGAATTAGGTAATTGTGGCCGG - Intergenic
997241781 5:132312907-132312929 ATGAGTTTGGAAAATGGGGCGGG + Intronic
997279664 5:132631991-132632013 CAGCTTTAGGAAAATGAAGCTGG - Intronic
997360224 5:133290352-133290374 GCGAATGAGGAAAATGGAGCTGG + Intronic
997703849 5:135929357-135929379 CACCATTAAGAAAATGAGGCTGG + Intronic
999686903 5:154111360-154111382 CAGAATTAGGAAATTCAGGCAGG + Intronic
1000080906 5:157845848-157845870 AAGAATTACTAAAATGCGGCCGG - Intronic
1000154252 5:158535086-158535108 CAGAACCAGGGAAAAGGGGCAGG - Intergenic
1000473258 5:161672651-161672673 CTGAATAAAGAAAATGTGGCAGG - Intronic
1000835904 5:166153854-166153876 TAGAAAAAGGAAAATGAGGCTGG - Intergenic
1001341850 5:170854438-170854460 CAGAATTTTGAAAATGGGCCAGG - Intergenic
1001651403 5:173318656-173318678 CATAATTAGGCAAATGGTGCAGG + Intronic
1001777301 5:174338258-174338280 CAGAATGAGAAAATTGGAGCTGG + Intergenic
1002541424 5:179908587-179908609 CAGAATTCTGACACTGGGGCCGG + Intergenic
1003603555 6:7540863-7540885 CAAAATTTGGAAAATGGACCTGG + Intergenic
1003780790 6:9423302-9423324 CAGAATTAGCCAAATTAGGCCGG - Intergenic
1004118227 6:12792167-12792189 TAGAACTAAGAAAATGGGCCGGG + Intronic
1004133977 6:12948973-12948995 AAGAAATAGAAAAATGGGCCAGG + Intronic
1004251889 6:14029596-14029618 AAAAATAAGGAAAATGAGGCTGG + Intergenic
1004644343 6:17544849-17544871 CAGAAATACTAAACTGGGGCTGG - Intronic
1004773723 6:18817998-18818020 CATAATAAGGAAAATGCTGCTGG + Intergenic
1008015567 6:46515382-46515404 CAGAATTTGAAAGATGGGGAGGG - Intergenic
1008537900 6:52521204-52521226 CAAAAGTAGGAAGATAGGGCTGG - Intronic
1010091351 6:71986382-71986404 CAAAATCAGGAAAATGGAGATGG + Intronic
1012099095 6:95007560-95007582 TAGAAGTAGCAACATGGGGCAGG - Intergenic
1012934600 6:105353472-105353494 AAAAATTAGCAAAATGGGGCCGG + Intronic
1012934651 6:105353789-105353811 AAGAATTAGCAAAATGGGTATGG + Intronic
1013172428 6:107648745-107648767 CAGAAATAGGAAAAGGTGGATGG - Intronic
1013331694 6:109108509-109108531 CAAAATAAGAAAAATGGGGCTGG - Intronic
1013374355 6:109499894-109499916 AAGAATTAGGTAAATTGGCCAGG - Intronic
1014465401 6:121750370-121750392 AAGGAAGAGGAAAATGGGGCAGG + Intergenic
1014515204 6:122369235-122369257 CAGAATTAAGAAAAAGGGTTTGG + Intergenic
1014711617 6:124812896-124812918 TAGAATTAGGAGAATGAGGAAGG - Intronic
1014911245 6:127096155-127096177 GAGAAATAGGAAACTGAGGCAGG + Intergenic
1015296353 6:131597787-131597809 ATGAATAAGGAAATTGGGGCTGG + Intronic
1015332031 6:131991330-131991352 AAGAATTAGAAAAATATGGCTGG + Intergenic
1015369928 6:132439225-132439247 CAGAATGAGGAACATAGAGCTGG + Intergenic
1017003144 6:150009864-150009886 AATTATCAGGAAAATGGGGCTGG - Intergenic
1018336172 6:162792302-162792324 CAGAAATAGGAGTAAGGGGCAGG + Intronic
1018998789 6:168729863-168729885 CAGAGTCAGGAAGAAGGGGCTGG - Intergenic
1019201550 6:170320445-170320467 TAGAATTAGGAAAATGGCAGTGG + Intronic
1019421718 7:954040-954062 CAGAAAGAGGAAATCGGGGCTGG - Intronic
1019583993 7:1786461-1786483 GAGAATTAGAAAATTGGGGCCGG - Intergenic
1019601471 7:1885853-1885875 AGGAATGAGGAAAATGGAGCAGG + Intronic
1020976381 7:15012349-15012371 CAGAAATAGGAACATGATGCGGG + Intergenic
1021074583 7:16286576-16286598 GAGAATTAGGAAATTGGTTCAGG - Intronic
1022381277 7:29862195-29862217 CAGAATAAGGTAAGTGGGCCAGG - Intronic
1022495349 7:30849846-30849868 CAAAATAAGGACAATGTGGCTGG - Intronic
1022813504 7:33892098-33892120 CAGGAGTGGGAAACTGGGGCAGG + Intergenic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1023620151 7:42063214-42063236 AACATTTAGGAAAATGTGGCTGG + Intronic
1024482129 7:49874829-49874851 CTGAATTAGGGAAGAGGGGCAGG - Intronic
1024635710 7:51288454-51288476 AACAATAATGAAAATGGGGCTGG + Intronic
1024841781 7:53595337-53595359 CTGAATGAGAAACATGGGGCTGG - Intergenic
1025035066 7:55588805-55588827 CAGAGTCAGGAGAATGGGGCAGG - Intergenic
1026499946 7:70935629-70935651 CTGAATAAGGAAGAGGGGGCAGG - Intergenic
1026763134 7:73141589-73141611 CAGAAAAAGGAAATTGGGCCAGG + Intergenic
1027039599 7:74951371-74951393 CAGAAAAAGGAAATTGGGCCAGG + Intergenic
1027084043 7:75251013-75251035 CAGAAAAAGGAAATTGGGCCAGG - Intergenic
1027424201 7:78046098-78046120 CAGAAATAGGAATGTGGGCCAGG + Intronic
1027512549 7:79101426-79101448 TAGAAAAAGGAAAATGGGGCCGG + Intronic
1028355587 7:89902398-89902420 CTGGATTAAGAAAATGTGGCAGG - Intergenic
1028712759 7:93928645-93928667 TAGAATTAGAAAAATCAGGCCGG + Intergenic
1029391616 7:100278779-100278801 CAGAAAAAGGAAATTGGGCCGGG - Intergenic
1030109615 7:106015653-106015675 TAGAATTAGACAAATGGGGCAGG - Intronic
1032392694 7:131566379-131566401 CAGAATTAGGGAGTTTGGGCAGG - Intergenic
1033894907 7:146057440-146057462 AAGAATTAGAAAAATGTAGCAGG - Intergenic
1035888875 8:3323312-3323334 AAGACTTGGGAAAATGGGGAAGG - Intronic
1038079054 8:24111580-24111602 CTGCATTAGGAAAAGGGGGAGGG - Intergenic
1038602133 8:28955653-28955675 TAGAAATAAGAAATTGGGGCTGG + Intronic
1039937905 8:42063668-42063690 AAGAACTAAGAAAATGGGGCCGG + Intergenic
1040354073 8:46598860-46598882 AAGAGTTGGGAAAATTGGGCAGG + Intergenic
1041177642 8:55213149-55213171 GAGGGTTAGGAAAATGAGGCTGG - Intronic
1041352491 8:56961938-56961960 CAAAGTTAGGGAAATGGGACTGG - Exonic
1041362334 8:57066746-57066768 AAGAATGACGAGAATGGGGCTGG - Intergenic
1041750852 8:61259707-61259729 CAGAATTTGAAAACTGGTGCTGG + Intronic
1042465806 8:69129394-69129416 CTGGATTAAGAAAATGTGGCAGG + Intergenic
1043811537 8:84748479-84748501 CAGAATTAGGAAAATGGGGCAGG - Intronic
1047296649 8:123576356-123576378 CAGAATTTGGATCTTGGGGCTGG + Intergenic
1047301836 8:123620159-123620181 CAGAAATGGGAAACTGGAGCAGG - Intergenic
1048516602 8:135116911-135116933 AAGAATTAAGAATGTGGGGCGGG + Intergenic
1050252607 9:3761099-3761121 CATAATCATGAAAATGTGGCTGG + Intergenic
1051192308 9:14526588-14526610 CAGAAATAGGAAAATTTAGCAGG - Intergenic
1051193627 9:14539420-14539442 AAGAGTTAGGGAAATTGGGCCGG + Intergenic
1051562891 9:18462640-18462662 TAGAAGAAGGAAAAAGGGGCCGG + Intergenic
1053062475 9:35043126-35043148 CAGAATCTGGAAGATGGGGAAGG - Exonic
1053286354 9:36851826-36851848 CAGAATTAAGAACAGAGGGCTGG + Intronic
1055803111 9:80062319-80062341 TAGAATTAGGAACATTTGGCTGG + Intergenic
1056291567 9:85148824-85148846 TATAATAAAGAAAATGGGGCAGG - Intergenic
1056326218 9:85480896-85480918 GAGAAAGGGGAAAATGGGGCAGG + Intergenic
1057220244 9:93253636-93253658 CAGAGCTATGAAAATAGGGCGGG + Intronic
1057414518 9:94849111-94849133 CAGAAATGCTAAAATGGGGCAGG + Intronic
1057857445 9:98612250-98612272 CAGAACTAGGATATGGGGGCTGG + Intronic
1058358339 9:104108881-104108903 CAGAAATAGAGAAATGGGGGTGG + Intronic
1058567487 9:106302135-106302157 CATAATTATAAAAATGGGGATGG - Intergenic
1059475106 9:114540306-114540328 CAGAATTATGCAAAGGAGGCCGG + Intergenic
1059859846 9:118447490-118447512 CAGAATTAGGAGACTGGAGCAGG + Intergenic
1061342749 9:129996296-129996318 CAGAATTAGCAAAGAGGGCCTGG + Intronic
1187474684 X:19600585-19600607 CTGGATAAAGAAAATGGGGCTGG + Intronic
1189351437 X:40278716-40278738 CACAAGAAGGAAAATGGGGCTGG + Intergenic
1192225255 X:69222996-69223018 CAGAGTGAGCAAAATGAGGCAGG + Intergenic
1192827299 X:74711088-74711110 CAGAATTAGGTAGGTGGGGTAGG - Intergenic
1193254557 X:79331852-79331874 GAGAATAGGGAAAATGAGGCAGG - Intergenic
1193637351 X:83968934-83968956 CAGAGTTAGGAAAAGCGGGGGGG + Intergenic
1194002527 X:88449487-88449509 CAGAAATAGGCAAATAGGGCTGG - Intergenic
1194142583 X:90223114-90223136 GAGAATAAGGCGAATGGGGCTGG + Intergenic
1196493351 X:116293700-116293722 GAGGGTTAGGAAAATGAGGCTGG + Intergenic
1196677832 X:118439278-118439300 AAGAAATAGCAAAATGGGCCAGG + Intronic
1197405696 X:126046250-126046272 CTCAATTAGGAAAATGATGCAGG - Intergenic
1197449026 X:126588250-126588272 CTGAATTAGGACCATGGGGATGG - Intergenic
1197645152 X:129009495-129009517 CAGATTTAGGAGAAGGGGACTGG - Intergenic
1197686084 X:129441140-129441162 AAGAATTAGGAAAAGAGGCCGGG + Intergenic
1198444826 X:136702001-136702023 AAGAATAAGAAAAATGAGGCCGG - Intronic
1199034397 X:143033243-143033265 GAGAATAAGGAGAACGGGGCTGG + Intronic
1199093021 X:143713262-143713284 GAGAATAAGGAGAATGGGACTGG - Intronic
1200488337 Y:3792215-3792237 GAGAATAAGGCGAATGGGGCTGG + Intergenic
1201277155 Y:12309829-12309851 AAGAAATAGCAAAATCGGGCTGG + Intergenic