ID: 1043812951

View in Genome Browser
Species Human (GRCh38)
Location 8:84765294-84765316
Sequence AAGAACAAGGAGAGGTAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043812945_1043812951 26 Left 1043812945 8:84765245-84765267 CCAAACTGGGTTTGAGTGGCATA 0: 1
1: 0
2: 2
3: 10
4: 160
Right 1043812951 8:84765294-84765316 AAGAACAAGGAGAGGTAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043812951 Original CRISPR AAGAACAAGGAGAGGTAGTG GGG Intronic
No off target data available for this crispr