ID: 1043812951 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:84765294-84765316 |
Sequence | AAGAACAAGGAGAGGTAGTG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1043812945_1043812951 | 26 | Left | 1043812945 | 8:84765245-84765267 | CCAAACTGGGTTTGAGTGGCATA | 0: 1 1: 0 2: 2 3: 10 4: 160 |
||
Right | 1043812951 | 8:84765294-84765316 | AAGAACAAGGAGAGGTAGTGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1043812951 | Original CRISPR | AAGAACAAGGAGAGGTAGTG GGG | Intronic | ||
No off target data available for this crispr |