ID: 1043812959

View in Genome Browser
Species Human (GRCh38)
Location 8:84765379-84765401
Sequence ACCCTGCCCCAGCAGCAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 7, 3: 18, 4: 285}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043812959_1043812965 28 Left 1043812959 8:84765379-84765401 CCTGTCTGCTGCTGGGGCAGGGT 0: 1
1: 0
2: 7
3: 18
4: 285
Right 1043812965 8:84765430-84765452 GCACGTGGGCTTTGCTCAATAGG No data
1043812959_1043812962 6 Left 1043812959 8:84765379-84765401 CCTGTCTGCTGCTGGGGCAGGGT 0: 1
1: 0
2: 7
3: 18
4: 285
Right 1043812962 8:84765408-84765430 TCTTTTGCTGGTTCAATGCTTGG No data
1043812959_1043812963 13 Left 1043812959 8:84765379-84765401 CCTGTCTGCTGCTGGGGCAGGGT 0: 1
1: 0
2: 7
3: 18
4: 285
Right 1043812963 8:84765415-84765437 CTGGTTCAATGCTTGGCACGTGG No data
1043812959_1043812964 14 Left 1043812959 8:84765379-84765401 CCTGTCTGCTGCTGGGGCAGGGT 0: 1
1: 0
2: 7
3: 18
4: 285
Right 1043812964 8:84765416-84765438 TGGTTCAATGCTTGGCACGTGGG No data
1043812959_1043812960 -6 Left 1043812959 8:84765379-84765401 CCTGTCTGCTGCTGGGGCAGGGT 0: 1
1: 0
2: 7
3: 18
4: 285
Right 1043812960 8:84765396-84765418 CAGGGTATCACCTCTTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043812959 Original CRISPR ACCCTGCCCCAGCAGCAGAC AGG (reversed) Intronic
900175850 1:1291053-1291075 ATCCTGCCCCAGGAGCAGCCTGG + Exonic
900641368 1:3689496-3689518 GCCCTGCCCCACCAGCAGGCCGG - Intronic
901640353 1:10689993-10690015 ACCTACCCCCTGCAGCAGACTGG + Intronic
901879474 1:12185495-12185517 AGTCTGCTCCAGCAGCAAACCGG + Intronic
902513403 1:16978011-16978033 AGCCTTCCACAGCAGCAGGCAGG - Intronic
902891523 1:19447756-19447778 ACCCAGCCCCAGCAGCTCGCAGG + Intronic
903128986 1:21266161-21266183 CCCCTATCCCAGCAGCATACGGG - Intronic
903499375 1:23793075-23793097 GTCCTGGCCCAGCAGCGGACTGG + Intronic
903655663 1:24947604-24947626 ACCCTGCCCCAGCAGATGGGAGG + Intronic
904035369 1:27556045-27556067 ACACTGACCCAACAGCAGACAGG - Intronic
904336900 1:29803726-29803748 CCCCTCCTCCAGGAGCAGACTGG - Intergenic
904405871 1:30287589-30287611 ATCCTGACCCAGAAGCTGACAGG - Intergenic
905547509 1:38811416-38811438 CACCTGCTCCAGAAGCAGACGGG + Intergenic
905891197 1:41519446-41519468 AGCCTGCCCCAGAAGAACACAGG + Intronic
905891722 1:41522230-41522252 ACCTGGCCCCAGAAACAGACAGG + Intronic
906521548 1:46469757-46469779 CCCCTGCCCCAGCCTCAGATGGG - Intergenic
907525159 1:55049733-55049755 ACCCTGTCCCAGCAGGACAGTGG + Intronic
907662853 1:56409245-56409267 ACCCAGCCCCATCAGCAGGTGGG + Intergenic
910142028 1:84036807-84036829 ACCCAGACCCAGCAGAAGAAAGG - Intergenic
911707040 1:101025917-101025939 GCCCTGCCCCAGCAGCCGGCGGG - Intronic
913583999 1:120255178-120255200 ACCCTGCCCCAACATGAGGCAGG + Intergenic
913624182 1:120643163-120643185 ACCCTGCCCCAACATGAGGCAGG - Intergenic
914917239 1:151826195-151826217 ACCCTGCCCCAGGCCCAGATTGG - Intronic
914968222 1:152280580-152280602 ACCCTAACCCAGCAGAAGAAAGG + Intergenic
915393308 1:155562967-155562989 CTCCTGCCCCTGCAGCCGACAGG - Intergenic
915629235 1:157138658-157138680 ACCCTGGCCCAGCAGCGGACCGG - Intergenic
917067720 1:171115024-171115046 AGCATCCCCCAGCAGCAGGCTGG + Intronic
918097168 1:181345109-181345131 CCCCTGCCTCAGCTGCAGCCTGG + Intergenic
918162564 1:181914975-181914997 AGCCTGCCTCAGCACCAGCCTGG - Intergenic
918844111 1:189586554-189586576 TCCCTGCCCCAGCACCAGGATGG - Intergenic
919666740 1:200299987-200300009 ACCCTGCCCCAGCAGCAGCACGG + Intergenic
919879337 1:201891718-201891740 CCCCTGCCCCCGGGGCAGACAGG - Intronic
920682637 1:208084480-208084502 AATCTGCCCCAGCCGCAGTCCGG - Exonic
922766108 1:228157421-228157443 ACCCAGCCCCAGCCGCATCCAGG - Intronic
922975451 1:229779971-229779993 ACACTTCCCCATCAGCAGATGGG + Intergenic
923134165 1:231102996-231103018 ACCCTGCCCCAGCAGAAAACTGG - Intergenic
924394773 1:243607064-243607086 ACTCTGCCCCTGCAGCAGACTGG - Intronic
1064496080 10:15911890-15911912 ACCGTGACCCAGAAGCCGACAGG - Intergenic
1065703086 10:28444348-28444370 CCCCTGCCCCAGAAGGAGAATGG + Intergenic
1069717540 10:70530591-70530613 ACCCTGCCTCAACATCCGACAGG - Intronic
1069783163 10:70969486-70969508 ACCCTGCCCAAGCGGCACGCTGG + Intergenic
1070841799 10:79492559-79492581 ACCCTGCCCAGGAAGCAGAATGG + Intergenic
1072155142 10:92717065-92717087 CCCCTCCCCCAGGGGCAGACAGG + Intergenic
1072861193 10:99007042-99007064 GGCCTGCCCCAGCACCAGATTGG - Intronic
1074160096 10:110829888-110829910 GCCCAGCCCCAGCAGAAGAGAGG + Intronic
1075024229 10:118972164-118972186 CTCCTGCCCCAGCGGGAGACTGG + Intergenic
1075274108 10:121078150-121078172 ACCCTGCCCGGGGAGCAGGCTGG - Intergenic
1076328377 10:129645873-129645895 ACACTTCCCCATGAGCAGACAGG - Intronic
1076595136 10:131620476-131620498 CTGCTGCCCCAGCCGCAGACAGG - Intergenic
1076678463 10:132159908-132159930 ACCCCCCCCCAGCATCACACAGG - Intronic
1076784767 10:132744342-132744364 GCCCTGCTCCCGCAGCAGAGCGG + Intronic
1079168980 11:18074046-18074068 ACCCAGCACCGGCTGCAGACTGG + Intronic
1081537180 11:44004575-44004597 GCCCAGCCCCAGCCGCAGGCAGG + Intergenic
1083338752 11:61945074-61945096 TCCCTGCCTCAGATGCAGACTGG - Intergenic
1083727522 11:64636293-64636315 ACCCGCCCCCAGCAGCCGGCTGG - Intronic
1083895488 11:65617821-65617843 GCCCAGCCACAGCAGCACACTGG - Intronic
1083912286 11:65717185-65717207 ACCCTGGCCAAGGAGCAAACTGG - Intronic
1084176429 11:67424692-67424714 ACCATGCCCCAGCCCCAGCCTGG + Exonic
1084425802 11:69084024-69084046 ACCCGCCACCAGCAGCAGCCTGG - Intronic
1084447490 11:69212312-69212334 CCCCAGCCCCAGATGCAGACAGG + Intergenic
1084557164 11:69882007-69882029 TCCCGTCCCCAGCAGCAGCCTGG - Intergenic
1084955446 11:72688907-72688929 ATCCTCCCCCAGCACCAAACTGG + Intronic
1085445430 11:76597911-76597933 ACCAAGGCCCAGCAGCAGTCAGG + Intergenic
1085526624 11:77167770-77167792 ACACACCCCCAGCAGTAGACAGG + Intronic
1088803654 11:113330984-113331006 ACACTTCCCTAGCAGCATACTGG + Intronic
1088918389 11:114244120-114244142 ACCCGGCCCCAGCAGCAAATGGG - Intronic
1089107642 11:116026759-116026781 ACCCAACCCCAGCAGAAGAAAGG + Intergenic
1091223461 11:133944428-133944450 CCCCTGCCCCAGCTAAAGACAGG + Intronic
1091300189 11:134502567-134502589 ACCCGGCACCAGCAGAAGCCCGG - Intergenic
1091308978 11:134559653-134559675 ACCATGTCCCAGAAGCAGCCAGG - Intergenic
1091334116 11:134753878-134753900 ACCCTCCCCCAACCCCAGACAGG - Intergenic
1091589352 12:1834293-1834315 ACCCTGCCCAAGGAGCTGAGGGG + Exonic
1092226765 12:6752985-6753007 ACCCTGACCCTGCAGCGTACCGG - Exonic
1093100293 12:15020177-15020199 ACCCTGCCCCAGCATCATCTTGG - Intergenic
1094817731 12:34204110-34204132 ACCCCGCCCCAGCTGGAGCCAGG - Intergenic
1095965542 12:47864721-47864743 ACCCTGACCCAGGAGTAGAAGGG + Intronic
1096807962 12:54151751-54151773 GCCCTGCCCCAGCAACACCCAGG - Intergenic
1099067555 12:78002280-78002302 AACATGCCCCAGCACCAGAAGGG + Intronic
1103504857 12:121435567-121435589 TTCCTTCCCCAGCAGAAGACTGG + Intronic
1104707307 12:130956640-130956662 ACCCGGCTCCTGCAGCAGGCAGG + Intronic
1106593965 13:31121377-31121399 GCTCTGCCCCAGCAGCAGCCTGG - Intergenic
1107808362 13:44175603-44175625 ACCATCCCCCAGCAGCAGCCAGG - Intergenic
1108359027 13:49652598-49652620 CCCCACCCCCAGCAGCAGGCAGG - Intergenic
1108999356 13:56778385-56778407 CCCCTGCCCCACTAGCAGTCTGG + Intergenic
1109975660 13:69828701-69828723 ACCTTGTCCCAGCATCAGCCTGG - Intronic
1113634267 13:111909242-111909264 CCCCTGGCACAGCAGCAGCCAGG + Intergenic
1113850578 13:113415240-113415262 ACCCTGCCCCACCCGGACACGGG - Intergenic
1114615849 14:24067977-24067999 GCCCTGCCCCAGCAGGAAAGGGG + Intronic
1117745031 14:58860673-58860695 ACCCGACCCCACCAGCAGAGGGG - Intergenic
1118335036 14:64846222-64846244 ACTCTGCCCCAGAAGTAGAGTGG + Intronic
1121141127 14:91543479-91543501 ACACTACCCCAGCAGTAGAAGGG + Intergenic
1121277211 14:92676586-92676608 ACCCTCCCCCAGCTGCAGGGCGG - Exonic
1121473626 14:94174826-94174848 TCCCTGCCCCAGCCCCGGACCGG + Intronic
1121574776 14:94975154-94975176 ACCCTGCCCCACCCGCTGGCTGG + Intergenic
1122803594 14:104245313-104245335 ACCTTGCCCGAGCTACAGACAGG + Intergenic
1122937387 14:104966496-104966518 ACACTGCCCCACCACCTGACAGG + Intronic
1124241353 15:28030637-28030659 TCCCTGCCCTGGCTGCAGACTGG + Intronic
1126415639 15:48415160-48415182 TCCCTGCCCCAGGAGAAGAGTGG + Intronic
1126438871 15:48665409-48665431 ACCCTGCACCTGCAGGAGGCTGG + Intergenic
1127274883 15:57433668-57433690 TCCCCACCCCAGCAGCAGCCTGG + Intronic
1128514881 15:68335843-68335865 ACCCTGCCACAGGAGGAAACAGG + Exonic
1129249566 15:74301391-74301413 TCCCTGCCCCAGCTGGACACAGG - Intronic
1129907663 15:79200510-79200532 AACCTTCCCCTGCAGCACACAGG - Intergenic
1131456333 15:92585242-92585264 ACCCAGCCCCAGCCCCAGAGCGG - Intergenic
1132740819 16:1412112-1412134 ACCCTCCGCCAGCAGCCCACAGG + Intronic
1132805362 16:1772757-1772779 ACCCCGCCCCTGCAGCCGCCTGG - Intronic
1132923173 16:2410809-2410831 ACTCACCACCAGCAGCAGACTGG - Intergenic
1133037416 16:3041545-3041567 GCCCTTCCCCAGAAGCAGTCTGG + Intergenic
1133380048 16:5322319-5322341 CCCCAGCCCCAGGAGCAGGCAGG - Intergenic
1133812180 16:9169166-9169188 CCTCTGTCCCAGAAGCAGACTGG - Intergenic
1135810588 16:25583267-25583289 ACCCTGCCCAAGCCTCTGACTGG - Intergenic
1136368411 16:29820604-29820626 TCCCTGCCCCAGCAGAAGCAAGG - Intronic
1136669087 16:31839720-31839742 AATCTGCCCCAGCACCAGGCTGG + Intergenic
1137290932 16:47051431-47051453 AGCCTGGCCCAGGACCAGACAGG - Intergenic
1137571021 16:49566376-49566398 ACCCTGCTCCTGGAGCAGATGGG + Intronic
1137960820 16:52880243-52880265 ACCCTCCCCCAGATGCAGAACGG - Intergenic
1138133175 16:54499595-54499617 AACTTGTCCCAGCTGCAGACAGG + Intergenic
1138551120 16:57749086-57749108 ACCCAGCTCCAGCGCCAGACAGG + Intronic
1138621924 16:58218367-58218389 ATCCTTCCTCAGCAGGAGACTGG + Intergenic
1139231098 16:65283280-65283302 ACCCCCCCTCAGCACCAGACAGG - Intergenic
1139519152 16:67470368-67470390 ACCATGCCCCAGCATCATGCAGG + Intronic
1140818033 16:78638629-78638651 ATGGTGCCCCAGCAGCAGGCTGG + Intronic
1141558483 16:84851686-84851708 ACCATGCAAGAGCAGCAGACTGG + Intronic
1141608309 16:85168106-85168128 TCCCGTCCCCATCAGCAGACTGG + Intergenic
1143287111 17:5798399-5798421 ACTCTACCCCTGCAGCAGCCTGG - Intronic
1143506401 17:7368121-7368143 ATCTTGCCCCAGCAGGAAACCGG - Intergenic
1144864005 17:18323372-18323394 ACCCTGCCCCACCAAGGGACTGG - Intergenic
1146066458 17:29639533-29639555 GCCCCACCCAAGCAGCAGACAGG - Intronic
1146401478 17:32503366-32503388 GCCCTGCCCCTGCAGAAGCCAGG + Intronic
1146736255 17:35241842-35241864 AGCCTGCGCCAGGCGCAGACTGG - Intergenic
1147218085 17:38912453-38912475 ACCCTGGCCCAGCGGCACCCTGG - Intronic
1147383564 17:40069582-40069604 ACCCTCCCCCAGCAGCCAGCGGG - Intronic
1147477602 17:40727868-40727890 ATGCTGCCCCAGCTGCCGACCGG - Intergenic
1147579525 17:41620457-41620479 ACCCTGCCCCAGCAACGTGCAGG + Intronic
1147605918 17:41773631-41773653 CCCCTTCCCCAGCAACAGAGGGG + Intronic
1147746573 17:42698627-42698649 CACCAGCCCCAGCAGCAGAAAGG - Exonic
1148048835 17:44759453-44759475 TCCCTGCCCCTGCCGCCGACCGG + Intronic
1148647868 17:49229793-49229815 ACCACGCCCGAGCAGCAGATAGG + Intronic
1149122147 17:53182408-53182430 ACCCAAACCCAGCAGCAGAAAGG - Intergenic
1150242209 17:63643699-63643721 ACCCTCCCACAGGGGCAGACAGG + Intronic
1152086285 17:78220959-78220981 ACCCTGGCAAGGCAGCAGACAGG - Intronic
1152642419 17:81454727-81454749 GCCCTGCCCCAGACTCAGACAGG + Intronic
1152761230 17:82108009-82108031 AGCCTGCCCCAGGAGCAGGTGGG - Intronic
1152941219 17:83173742-83173764 ACCCTGCCCCACCACCACTCAGG - Intergenic
1154297401 18:13162743-13162765 CCCCTTCCACAGCAGCAGCCTGG + Intergenic
1157794941 18:50564800-50564822 GCACTGCCCAAGCAGCAGGCGGG - Intronic
1160186735 18:76681797-76681819 ACCCTTCCCCATCAGCCGCCCGG + Intergenic
1160199472 18:76784032-76784054 ACCCTGCCCCAGGAGGGGCCTGG - Intergenic
1160382549 18:78471692-78471714 CATCTGCTCCAGCAGCAGACGGG - Intergenic
1160428400 18:78794075-78794097 ACCCTGCCCCACCTGCTGGCAGG - Intergenic
1160491958 18:79345530-79345552 ACACTGCTGCAGCAGCACACAGG + Exonic
1161572306 19:5037225-5037247 ACCCTCCTGCAGAAGCAGACTGG + Intronic
1161778930 19:6279040-6279062 ATCCTGCCCCGGCTGCAGCCAGG - Intronic
1162331132 19:10030522-10030544 TCCCTGCCCTACCAGCTGACTGG - Intergenic
1162889525 19:13722427-13722449 ACCCTGGCCCATCAGCCCACAGG - Intergenic
1164769777 19:30799622-30799644 ATCCAGCTCCAGCAGCAGAGGGG - Intergenic
1165758684 19:38308462-38308484 CCCCTACTCCAGCAGCAGCCAGG - Intronic
1165819244 19:38664089-38664111 ACCCAGCCTCGCCAGCAGACTGG - Intronic
1166550279 19:43661272-43661294 TCCCTTCCACAGCAGCAGATTGG + Intronic
1166802186 19:45465185-45465207 ACTCGGCCCCAGCATCAGACAGG - Intronic
1166827635 19:45619290-45619312 ACCCTGCCCCAGCGGGACCCAGG + Intronic
1166884022 19:45947940-45947962 TCCCTTGCCCAGCATCAGACAGG - Intronic
1167604572 19:50475085-50475107 GCCATGCCCCAGCAGCGGTCAGG - Intronic
1168147890 19:54429924-54429946 AACCTGACCCAGGAGGAGACAGG + Exonic
1168240326 19:55086007-55086029 AGCCAGCCCTAGCTGCAGACAGG + Intronic
1168589925 19:57624764-57624786 TCCCAGCCCCAGCAGCATCCAGG - Intergenic
924989036 2:295446-295468 ACCCTCCCCCATGGGCAGACAGG + Intergenic
925769259 2:7266372-7266394 TCCGTGCCACAGCAGCAGAATGG - Intergenic
926219421 2:10925151-10925173 TCCCTGCTCCAACAGCAGCCAGG - Intergenic
927151155 2:20196917-20196939 CCCCTCCCCCAGCTGCAGCCAGG - Intergenic
927642977 2:24857136-24857158 ACCCTGCCAGAGCAGGAGAGGGG + Intronic
927762075 2:25766842-25766864 GCCTTACCCCAGCAGGAGACAGG - Intronic
927873172 2:26637119-26637141 GCCCTGCCCCAGCGGAAGACAGG - Intronic
927885291 2:26714482-26714504 ACCCCTCCCCAGCAGCAGTTGGG - Intronic
928374950 2:30766421-30766443 AACCTGTCCCAGCAGCAGCTGGG + Intronic
928399217 2:30965813-30965835 CCCCAGCCCCAGCATCAGGCTGG - Intronic
928947948 2:36789148-36789170 GCCCTCCCCCAGCAGCAGGGTGG + Intronic
930107502 2:47651532-47651554 ACCCTGCCCCAGAGGAAGAAGGG - Intergenic
931474580 2:62574471-62574493 CCCCTGTCCCAGCAGAAGTCTGG + Intergenic
932479042 2:72027724-72027746 CCCCTGCCCCAGGAGCAGGTGGG + Intergenic
933766694 2:85714116-85714138 GCCCTGCCCTGGCAGCACACTGG - Intergenic
935701207 2:105813562-105813584 ACACTGCGCCAGCACCACACAGG + Intronic
936089934 2:109494999-109495021 GCCCTGCCCCAGCAGCTGGCAGG + Intronic
937297859 2:120820541-120820563 ACCCTGCCCCAGCAACCCCCAGG + Intronic
937738452 2:125319363-125319385 TGCCTGCCCCAGCATCAGTCTGG - Intergenic
937986716 2:127641328-127641350 ACCATGCCGCAGCACCAGGCTGG - Intronic
938094537 2:128452825-128452847 ACCCTGGCGCTGCAGGAGACTGG - Intergenic
946040437 2:216778639-216778661 ACCCTGCCCCTGCAAGAGCCTGG + Intergenic
946278564 2:218649263-218649285 ACCCAGCTCCCGCAGCAGATGGG + Exonic
947665901 2:231905151-231905173 ACCCTGCCCCCTCAGCAGACAGG + Intergenic
948327729 2:237139986-237140008 ACCCAGCCCCAGCAGCGCATGGG - Intergenic
948345668 2:237295836-237295858 AGCCTGGCCCAGAAGCACACTGG + Intergenic
1169145484 20:3249245-3249267 CCCCCGCCCCAGGAGCACACGGG + Intergenic
1170240892 20:14164969-14164991 ACCTCACCCCAGCAGCAGAAGGG - Intronic
1172096706 20:32463996-32464018 ACTCTGTCACAGCAGCAGCCAGG + Intronic
1172619217 20:36308139-36308161 CCCCTGCCACAGCGGGAGACAGG - Intronic
1172689348 20:36779536-36779558 ACCCTGCCCCAGCAACCCCCCGG - Exonic
1173322306 20:41999002-41999024 GCCCTGCAGCAGCAGCAGGCGGG - Intergenic
1173715828 20:45204583-45204605 GACCTGCCCCAGCAGCAGAGAGG - Intergenic
1175191378 20:57214305-57214327 CCCCTGCCCCAGCAGCTTGCAGG + Intronic
1175262094 20:57681156-57681178 CCCCTGCCCCACCAGCACTCAGG - Intronic
1175746607 20:61461399-61461421 AACCTGCCACAGCAGCAGTGAGG + Intronic
1175802125 20:61806864-61806886 ACCCCTCCCCAGCAGGAGACAGG - Intronic
1180613698 22:17113914-17113936 GCTCTGCCCCAGAAGCAGGCTGG - Exonic
1180741519 22:18056266-18056288 CCCCTTCCTCAGCACCAGACTGG - Intergenic
1183298609 22:37046850-37046872 GCCCTGCCCCAGGCTCAGACAGG + Intergenic
1183329426 22:37211655-37211677 CCCCTGCCCCTGCAGCCGACCGG + Intronic
1183381145 22:37491164-37491186 AGGCTGCCCCAGCAGCAGTGAGG - Exonic
1183484735 22:38082815-38082837 ACCCAGCCCCAGCCGCCGTCTGG + Exonic
1183616149 22:38946964-38946986 GCCCTTCCCCAGCAGCAGCTGGG - Intergenic
1183661781 22:39225547-39225569 ACCCTGCCCCAGCTGATAACTGG + Intronic
1183712158 22:39511374-39511396 ACCCACCCCCAGCACCAGCCGGG - Exonic
1184212927 22:43047235-43047257 GCCCTGCCCAAGCAGCAGTGTGG + Intronic
1184699643 22:46162042-46162064 ACCCAGCCCTAGCAGGAGGCTGG - Intronic
1184854904 22:47141358-47141380 GCCCAGTCCCAGAAGCAGACAGG + Intronic
1185316693 22:50182410-50182432 TCCCTGCCCCAGCAGCCACCCGG + Intergenic
950503051 3:13376559-13376581 AGCCTCCACTAGCAGCAGACGGG + Intronic
951509264 3:23483805-23483827 ACCCTGCCCCAACAACAAAAAGG - Intronic
952744046 3:36761560-36761582 GCTCTGCTCCACCAGCAGACGGG + Intergenic
952833371 3:37584213-37584235 AACCTGCCCCAGTAGCCAACTGG - Intronic
953309672 3:41864296-41864318 TCCCCGCCCTAGCAGCAGCCTGG - Intronic
953414697 3:42708990-42709012 GCCCTGCGGCAGCAGAAGACAGG - Exonic
953730181 3:45440725-45440747 ATCCTGCCCAAGCAGCAGTGTGG + Intronic
953932086 3:47010472-47010494 ACCAGGACGCAGCAGCAGACAGG - Intergenic
954131917 3:48565197-48565219 ACCCTGCCCTACCTGCAGAGCGG - Exonic
954424880 3:50438071-50438093 ACCCTGTCCCACCAGCATCCTGG - Intronic
958003044 3:87775642-87775664 ACCCAAACCCAGCAGCAGAAAGG - Intergenic
961781645 3:129324104-129324126 AGCCTCCACTAGCAGCAGACGGG + Intergenic
962678524 3:137774739-137774761 AACCTCCCACAGCAGCAGAGAGG - Intergenic
962981305 3:140492878-140492900 AAACTGCCCCCGCAGGAGACAGG + Intronic
964660336 3:159113677-159113699 TGCCTGCCCCAGCATCTGACAGG - Intronic
965360000 3:167727097-167727119 ACCATGGCCCAGAAGCAGGCTGG + Intronic
968525857 4:1056842-1056864 ACACTGCCTCTGCAGCAGGCTGG + Intronic
968810806 4:2798941-2798963 ACCCCGCCCCAGCAGCTGGATGG - Intronic
968880326 4:3295188-3295210 ACCTTCCCACAGCAGCAGCCAGG - Intronic
969042700 4:4313226-4313248 ACCCTGCCACTGCAGAACACAGG + Intronic
971011016 4:22435121-22435143 TCCCGGTCCCAGCAGCAAACAGG + Intronic
971068822 4:23066944-23066966 ACCATGGCCCAGCAGGATACAGG - Intergenic
971092326 4:23360445-23360467 ACCCAGCCACAGCTGCAGATGGG + Intergenic
971367097 4:25986081-25986103 ACTCTGCCCCAGCCCCACACGGG + Intergenic
972404151 4:38730755-38730777 AACCTGCACCAGAGGCAGACAGG - Intergenic
973334139 4:48938722-48938744 TCCCTGCCCCAGGATCAGGCAGG - Intergenic
974328216 4:60443672-60443694 ACTTTGCCCCAGTACCAGACTGG - Intergenic
975022249 4:69503461-69503483 TACTTGCCCCAGCAGCACACAGG + Intronic
976202397 4:82592377-82592399 TCCCTGCCCCAGCAACATATGGG - Intergenic
980982600 4:139667427-139667449 CCCCTGCACAAGCAGCAAACAGG - Intronic
982533512 4:156578366-156578388 ACGCTGCCCCAGCAGCACAGGGG + Intergenic
985645957 5:1084886-1084908 CCCAGGCCCCAGCAGCAGCCAGG + Intronic
985759429 5:1737537-1737559 ATGCTGCCCCAGCACCAGCCAGG + Intergenic
985774066 5:1831596-1831618 CCCCTGCCCCAGCAGCACCAGGG - Intergenic
985781538 5:1874251-1874273 AGCCTGCCCCATCAGAAGAATGG - Intergenic
986093747 5:4536190-4536212 AGCCTGCACCAGCAGAAGCCAGG + Intergenic
987484725 5:18510599-18510621 CCCCTGCCCCACCTGCTGACAGG - Intergenic
988488089 5:31683706-31683728 AGCCTGCCTCAACAGCAGACTGG - Intronic
988667057 5:33340527-33340549 CCCCAACCCCAGCAGAAGACTGG + Intergenic
996755481 5:126930620-126930642 ACCCTGCTCCAGCACCATGCTGG + Intronic
998092590 5:139379996-139380018 CCCTTGCCCCAGCGGTAGACAGG + Exonic
998486976 5:142511534-142511556 GCCCTTCCCCACCAGCAGCCTGG - Intergenic
999384583 5:151145197-151145219 CTCCTGCTCCAGCAGCAGCCTGG - Intronic
1000237015 5:159371289-159371311 GCCCTGCTCCAGAAGCTGACTGG + Intergenic
1001310187 5:170604768-170604790 GCCTTGCCCCACCAGAAGACTGG + Intronic
1009871086 6:69452465-69452487 ACCCAGCTCCTGCTGCAGACTGG - Intergenic
1009969097 6:70607608-70607630 ACCCAACCCCAGCAGAAGAAAGG + Intergenic
1010181639 6:73093432-73093454 ACCCAGACCCAGCAGAAGAAAGG - Intronic
1011893043 6:92191404-92191426 ACCCAAACCCAGCAGAAGACAGG - Intergenic
1014531134 6:122561066-122561088 ACCCAGGCCCAGCAGAAGAAAGG - Intronic
1017190224 6:151645723-151645745 ACCCAACCCCAGCAGAAGAAAGG - Intergenic
1018914284 6:168123323-168123345 ACCCTGAGCCAGCAGGAGTCTGG - Intergenic
1019033605 6:169034883-169034905 ACCCAGTCCCAGCAGCAGACAGG - Intergenic
1019290121 7:246170-246192 GCCCTGACCCAGCTGCCGACGGG - Intronic
1019398415 7:836088-836110 CACCTCCCCCAGCAGCCGACAGG - Intronic
1019436523 7:1025108-1025130 ACCCAGCCCCAGGGGCAGGCAGG + Intronic
1019645613 7:2127310-2127332 ACCCAGCCCCAGCAAGACACAGG + Intronic
1019667651 7:2259781-2259803 TCCCTGGCCCAGCAGAAGAGGGG + Intronic
1019754048 7:2755132-2755154 TCCCTGCGCCAGCACCACACAGG + Intronic
1026268542 7:68816617-68816639 ACACAGAGCCAGCAGCAGACAGG + Intergenic
1028124977 7:87102691-87102713 ACCCTGTCCCATCAGCAGCAAGG + Intergenic
1028751916 7:94392215-94392237 ACCCTGCCACATCAGCAGGGAGG + Intergenic
1028879129 7:95859759-95859781 GACCTGCCCCAGCACCAGGCAGG - Intronic
1033822031 7:145146658-145146680 ACCCTTCTCCAGCTTCAGACTGG + Intergenic
1034423617 7:151001690-151001712 ACCCTGCCCCAGCAGTGTTCTGG + Intronic
1036097597 8:5741285-5741307 CCCCTGCCCCTGCAGCAGACAGG + Intergenic
1039769801 8:40673866-40673888 ACCATGCCCCTGCCCCAGACAGG - Intronic
1039936910 8:42052694-42052716 TCCCTCCCCCAGCAGCTGAGAGG + Intergenic
1039966587 8:42288557-42288579 ACCCCTCCCATGCAGCAGACAGG + Intronic
1040013500 8:42681767-42681789 AAGCTGCCCCAGAAGCAGATGGG - Intergenic
1040817334 8:51522391-51522413 ACCATGCCCCACAGGCAGACTGG + Intronic
1040935988 8:52782698-52782720 AACATTCCCCAGCAGCAGCCTGG + Intergenic
1041248212 8:55909158-55909180 ACCCTGACCCAGAAGCAGGTGGG + Intronic
1043812959 8:84765379-84765401 ACCCTGCCCCAGCAGCAGACAGG - Intronic
1044610989 8:94091953-94091975 ACCCTGCCCCTACAGGAGGCAGG - Intergenic
1051949116 9:22609427-22609449 ACCCTGCCCCAACAACAGCAAGG - Intergenic
1056421478 9:86431867-86431889 ACCATGCCCCACCAACAGAATGG - Intergenic
1058959561 9:109979916-109979938 ACTCTCCCCCAGACGCAGACAGG + Intronic
1059162798 9:112051024-112051046 CCCCTGCCCTGGCAGCAGAATGG - Intronic
1060214490 9:121730508-121730530 ACCCTGCCCCTGCAGCCTGCTGG - Intronic
1060390689 9:123274185-123274207 ACCCTGCCCCAGCTGAAGGTGGG + Intergenic
1062392008 9:136337596-136337618 GCCCTGCCCCTGCAGCAGCCCGG - Intronic
1062395077 9:136349575-136349597 ACCCCTCCCCAGGAGCAGAATGG + Exonic
1062682512 9:137789294-137789316 CCCCTGCGCCAGCACCAGGCCGG - Intronic
1187327599 X:18306360-18306382 ACCCTACCCCAGCATCTGCCTGG + Intronic
1187488219 X:19724820-19724842 ACCCTGCCTCAAAAGCAGTCAGG - Intronic
1187587091 X:20675310-20675332 ATGCTGCCCTAGCAGCAGAATGG + Intergenic
1192796173 X:74425510-74425532 ACCCAGACCAAACAGCAGACAGG + Intronic
1197415246 X:126165905-126165927 ACCATGGCCCAGCAGCAAACAGG - Exonic
1197445966 X:126552589-126552611 ACCATGGCCCAGCAGCAAACAGG - Exonic
1197726412 X:129779913-129779935 ACCCGGCAGCAGCAGCATACAGG - Intergenic
1198886017 X:141338432-141338454 ACCCAGACCCAGCAGAAGAAAGG - Intergenic
1199095707 X:143736082-143736104 ACCCAACCCCAGCTGCAGAGTGG + Intergenic
1199988320 X:152968580-152968602 ACCCTGGGCCAGCAGCAGGATGG + Intronic
1200022695 X:153225576-153225598 TCCCAGCCCCAGCAGCTGATAGG - Intergenic