ID: 1043812960

View in Genome Browser
Species Human (GRCh38)
Location 8:84765396-84765418
Sequence CAGGGTATCACCTCTTTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043812959_1043812960 -6 Left 1043812959 8:84765379-84765401 CCTGTCTGCTGCTGGGGCAGGGT 0: 1
1: 0
2: 7
3: 18
4: 285
Right 1043812960 8:84765396-84765418 CAGGGTATCACCTCTTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043812960 Original CRISPR CAGGGTATCACCTCTTTTGC TGG Intronic
No off target data available for this crispr