ID: 1043814212

View in Genome Browser
Species Human (GRCh38)
Location 8:84781693-84781715
Sequence CAGTGGGAATTGAGGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043814205_1043814212 24 Left 1043814205 8:84781646-84781668 CCATGCAATCAATTTTAAAAGGA 0: 1
1: 0
2: 1
3: 45
4: 500
Right 1043814212 8:84781693-84781715 CAGTGGGAATTGAGGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043814212 Original CRISPR CAGTGGGAATTGAGGGAGGT GGG Intronic
No off target data available for this crispr