ID: 1043818096

View in Genome Browser
Species Human (GRCh38)
Location 8:84828457-84828479
Sequence TTTCAAGCCAGTATTTATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043818093_1043818096 27 Left 1043818093 8:84828407-84828429 CCCAAGGTAATCTTCTAAAATGT 0: 1
1: 0
2: 3
3: 36
4: 385
Right 1043818096 8:84828457-84828479 TTTCAAGCCAGTATTTATGGAGG No data
1043818094_1043818096 26 Left 1043818094 8:84828408-84828430 CCAAGGTAATCTTCTAAAATGTC 0: 1
1: 0
2: 2
3: 23
4: 447
Right 1043818096 8:84828457-84828479 TTTCAAGCCAGTATTTATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043818096 Original CRISPR TTTCAAGCCAGTATTTATGG AGG Intronic
No off target data available for this crispr