ID: 1043821831

View in Genome Browser
Species Human (GRCh38)
Location 8:84875961-84875983
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043821826_1043821831 5 Left 1043821826 8:84875933-84875955 CCAGCAGAGAAATAATGGCAGGA 0: 1
1: 0
2: 1
3: 29
4: 198
Right 1043821831 8:84875961-84875983 ATGGAGAATCTGAAAGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr