ID: 1043823499

View in Genome Browser
Species Human (GRCh38)
Location 8:84897048-84897070
Sequence ATTCAATTCCATTTCTATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 283}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043823499_1043823502 17 Left 1043823499 8:84897048-84897070 CCTACATAGAAATGGAATTGAAT 0: 1
1: 0
2: 3
3: 31
4: 283
Right 1043823502 8:84897088-84897110 TATTTAACTTCTTTCAGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043823499 Original CRISPR ATTCAATTCCATTTCTATGT AGG (reversed) Intronic
901849365 1:12005836-12005858 ATTGAGTTCCATTTCTCTCTCGG + Exonic
905342552 1:37289301-37289323 ATTCATTTCCATTGATCTGTGGG - Intergenic
909731741 1:78900249-78900271 ATTCATTTCCATTTTTATTCAGG - Intronic
909764080 1:79332793-79332815 AATCATTTCCATTTCCATGAGGG - Intergenic
909978942 1:82075173-82075195 TTTAAATTCCATCTCTATATTGG + Intergenic
910309534 1:85807958-85807980 ATCCAATTCCATTTCCAAGTGGG + Intronic
910783096 1:90963270-90963292 ATTCAATTCCATTTGGATCAGGG + Intronic
911488250 1:98529083-98529105 ATTTAATTCTATTTATATGTTGG - Intergenic
912141939 1:106740743-106740765 AGTCAAATTCATTTCTATCTAGG + Intergenic
912247174 1:107971613-107971635 ATTTAAATCCATTTGCATGTTGG + Intergenic
913048418 1:115093320-115093342 ATACAATGCCATTTATATGAAGG - Intergenic
913275829 1:117136935-117136957 GTTCAATGACATTTGTATGTAGG + Intergenic
917053020 1:170946126-170946148 ATTCAACTTCATCTTTATGTGGG - Intronic
917202827 1:172534775-172534797 ATTCATTTCCATCTCTTTCTGGG + Intronic
917379525 1:174389720-174389742 ATTAAATGCCTTTTATATGTGGG + Intronic
918621588 1:186611731-186611753 TAACAATTCCATTTTTATGTTGG + Intergenic
918730642 1:187990511-187990533 ATTCATTTCTTTTTCTTTGTTGG + Intergenic
919097576 1:193056672-193056694 ATTCATTTCCCTTTCAATGATGG + Intronic
920118251 1:203636497-203636519 AGTCAATTCCCCTTCTGTGTTGG + Intronic
921491524 1:215782155-215782177 GTTCAATTCCATTTCGAAGAAGG + Exonic
921882894 1:220274342-220274364 ATTGAATTTCATTACTGTGTTGG + Intergenic
922519958 1:226241259-226241281 ATTTAATTTCATTTCCTTGTTGG + Intronic
924371631 1:243357062-243357084 CATAAATTCCATTGCTATGTGGG - Intronic
924416348 1:243860378-243860400 ACTCAACTCCATTTCTATTTTGG - Intergenic
1063325063 10:5090773-5090795 ATGCCATTCCATTACCATGTAGG - Intronic
1063997493 10:11634288-11634310 ATTCCATTGTATTTCTATGCAGG - Intergenic
1065433822 10:25686106-25686128 CTTTAATCCTATTTCTATGTAGG + Intergenic
1065819106 10:29508944-29508966 TTTCAATTCCATCCCTATTTCGG - Intronic
1066517050 10:36174234-36174256 ATACAATTTCCTTTCTATATTGG - Intergenic
1068045372 10:51879780-51879802 ATTCAATTCCACTGTTATCTAGG - Intronic
1068613885 10:59090417-59090439 ATTCAAATCCATTTATATCTGGG + Intergenic
1069293956 10:66820150-66820172 ATTTCATTCCATTTTTATGATGG - Intronic
1071956811 10:90769722-90769744 TTTAAATTCCTTTTCTAGGTTGG - Intronic
1073087101 10:100899436-100899458 GTGAAATTCCATTTGTATGTGGG - Intergenic
1073836815 10:107453722-107453744 CTTCAATACCATTTTTATTTTGG - Intergenic
1073916138 10:108406366-108406388 ATTCAATTTTATTTTTATATTGG - Intergenic
1073993384 10:109289189-109289211 ATTCAATGCCATTTTTATTTGGG - Intergenic
1074050087 10:109873897-109873919 ATACAATTCTATTTCTATGAAGG + Intronic
1074813697 10:117129023-117129045 ATTTAACACCATTTCTACGTCGG - Intronic
1074912333 10:117922921-117922943 ATTCATTTCCAGTTCTAGGTTGG - Intergenic
1077927533 11:6696809-6696831 ATTTTCTTCCATTTGTATGTAGG - Intergenic
1078657453 11:13255089-13255111 ATTCCATTCCCTTTCTCTTTGGG - Intergenic
1079576905 11:22015547-22015569 CTTCAATTCCATTTATAAGTAGG + Intergenic
1079585347 11:22119811-22119833 ATTCAATTCCCTTTTAGTGTAGG - Intergenic
1079749890 11:24184286-24184308 TTTCATTTGCATTTCTCTGTTGG - Intergenic
1080096397 11:28413168-28413190 ATTTAATACCATTTATATATGGG + Intergenic
1080541693 11:33272420-33272442 ATTCAATGTCGTTTCTTTGTGGG + Intronic
1080945045 11:36962747-36962769 TTTAATTTGCATTTCTATGTTGG - Intergenic
1080986234 11:37469570-37469592 AATCAATTGCATATCAATGTAGG - Intergenic
1080991084 11:37536057-37536079 ATTCAATTCTATTTCTTTTCAGG + Intergenic
1081099318 11:38982587-38982609 TCTCCATTCCATTTCTTTGTTGG + Intergenic
1081452567 11:43185983-43186005 ATTCTGTTCCATTGGTATGTTGG - Intergenic
1082226052 11:49708453-49708475 ATGCAATTACAGTTCTGTGTAGG + Intergenic
1085696093 11:78706011-78706033 ATTCATTTCCATATCTCTGATGG + Intronic
1086311652 11:85542094-85542116 ATTCATTTCTCTTTCTCTGTGGG - Intronic
1086592874 11:88536590-88536612 ATTCAATTCTGTTCCCATGTTGG + Intronic
1086623042 11:88911287-88911309 ATGCAATTACAGTTCTGTGTAGG - Intronic
1087442606 11:98205989-98206011 AGTCAATTTCATATCTATATGGG - Intergenic
1088225749 11:107617957-107617979 ATTGAATTGCATTGCTCTGTGGG + Intronic
1090550129 11:127810215-127810237 CTTCAATTACATTACTTTGTTGG - Intergenic
1091522807 12:1264733-1264755 TTTCCTTTCCATTTCTTTGTGGG + Intronic
1092917641 12:13202947-13202969 ATTCAATTCCATTTCTCCTTTGG + Intronic
1093336909 12:17916127-17916149 ATTCCATTTTATTTCTTTGTTGG - Intergenic
1094235833 12:28164987-28165009 ATTCAATTCCACTTTTGTGCTGG - Intronic
1094272010 12:28627184-28627206 CTTCAATTTCTTTGCTATGTTGG - Intergenic
1095265200 12:40148001-40148023 ATCCCATTCCATGCCTATGTCGG - Intergenic
1097792311 12:63828162-63828184 ATTCATTTTAATTGCTATGTAGG - Intergenic
1099423871 12:82499295-82499317 TTCCATTTCCATTTATATGTTGG - Intergenic
1099705978 12:86153384-86153406 ATTCAATGCTATGTCTATTTTGG - Intronic
1099991432 12:89726304-89726326 ATTCCATTTCATTTGTCTGTGGG - Intergenic
1100124652 12:91408705-91408727 GTTCAGTGCCATTTCTAGGTTGG - Intergenic
1103227803 12:119303197-119303219 GTTTAATGCCATTTCGATGTGGG - Intergenic
1103644625 12:122381501-122381523 TTTCAATTCACTTTCTATGGAGG - Intronic
1104516989 12:129436791-129436813 CTTCAAGTTCATTTTTATGTCGG - Intronic
1105459371 13:20569045-20569067 TTGGAATGCCATTTCTATGTGGG + Intronic
1106503562 13:30352424-30352446 ATTTATTTCCATCCCTATGTAGG + Intergenic
1106778077 13:33027618-33027640 ATTCAATTCCATCTCCTTGTAGG + Intronic
1106991779 13:35428691-35428713 ATTCTCTGCCATTTCGATGTTGG + Intronic
1108283672 13:48884405-48884427 AATCACTTCCAGTACTATGTGGG - Intergenic
1109505456 13:63295400-63295422 ATTCATTTGCATTTCTTTTTTGG - Intergenic
1109784803 13:67159459-67159481 ATTCCATTCCATTTCAAGATGGG - Intronic
1109910065 13:68897924-68897946 ATTCTTTTACATTTGTATGTTGG - Intergenic
1110981631 13:81907369-81907391 ATTCAATTTCATTTTTATGTAGG + Intergenic
1111387588 13:87546812-87546834 ATGCAATTTCATTTTCATGTTGG - Intergenic
1111877296 13:93913159-93913181 TTTCAATTCATTCTCTATGTAGG - Intronic
1112200620 13:97270732-97270754 ATTCTATTACATCTATATGTTGG + Intronic
1113469728 13:110535812-110535834 AATGAAATCCATTTCTGTGTTGG - Intronic
1113537395 13:111078811-111078833 ATACAATTCCAGTTATATGTAGG - Intergenic
1115037824 14:28882265-28882287 CTTTAATTCCATTTCAATATGGG - Intergenic
1115318785 14:32055837-32055859 ATTCATTTCCATTTATCAGTTGG + Intergenic
1116676766 14:47916155-47916177 ATTCAAATCCATACCTATGTCGG - Intergenic
1119059040 14:71455605-71455627 ATTTAATTTAATTTATATGTGGG + Intronic
1122404874 14:101494448-101494470 GTACAATTCCATTTATATGAGGG + Intergenic
1122680601 14:103458657-103458679 CTATAATTCCATTTCAATGTAGG - Intronic
1202831465 14_GL000009v2_random:38799-38821 ATTCTATTCCATGTCTATACTGG + Intergenic
1124514932 15:30359646-30359668 CAGCAATTCCATTTCTAAGTTGG + Intergenic
1124727990 15:32171116-32171138 CAGCAATTCCATTTCTAAGTTGG - Intronic
1126543771 15:49850357-49850379 ATTCAATACTATTTCTATCAAGG + Intergenic
1127345342 15:58090878-58090900 ATTCTCTTCCATTCTTATGTTGG - Intronic
1128270422 15:66304571-66304593 ATTCAGTTTCATTTCTATGAAGG - Intronic
1129654395 15:77514320-77514342 ATATAATTTCATTTCTATGAAGG + Intergenic
1130823660 15:87521195-87521217 ATTCAATGCCATTGTCATGTAGG + Intergenic
1131803327 15:96095277-96095299 ATTCTATTCTATTTCTATCATGG + Intergenic
1133461216 16:5988109-5988131 ATTCAATTCGCATTCTATCTTGG + Intergenic
1133953347 16:10417814-10417836 ATTCTATTCCATTTGTGTATAGG - Intronic
1135226023 16:20658822-20658844 ATTAAATTCCAATTTAATGTTGG + Intronic
1135675823 16:24414093-24414115 GTTCAATTCCATAACTCTGTTGG - Intergenic
1140341247 16:74165562-74165584 CTTCAGTTCCATTTTTATGAAGG - Intergenic
1140581807 16:76239919-76239941 ATAAAATTCCATTTCTATTATGG - Intergenic
1141112942 16:81285254-81285276 ATTCTCTTTGATTTCTATGTTGG + Intronic
1141235488 16:82211979-82212001 ATTCAATTTCAATTCAATATTGG - Intergenic
1141294492 16:82754285-82754307 ATGCAGTTCCATTTCTATGTGGG - Intronic
1142271949 16:89094321-89094343 ATTCACTTCCATTTCTCATTGGG + Intronic
1144268907 17:13599399-13599421 AATCATATCCATTTCTGTGTTGG + Intronic
1146978749 17:37139811-37139833 ATCCAATTTCTTTTCTATCTTGG + Intronic
1147489207 17:40848562-40848584 TTTCAATTCCATTATCATGTAGG + Intergenic
1151071207 17:71214433-71214455 ATACAGTTCCCTTTCTATCTTGG - Intergenic
1152516804 17:80830014-80830036 ATTCAATTCCCTATCAAAGTTGG - Intronic
1203169532 17_GL000205v2_random:135225-135247 AGTCAACACCATTGCTATGTCGG + Intergenic
1153101950 18:1482010-1482032 ATTCAATTCCATTTTAATTATGG + Intergenic
1153147208 18:2046994-2047016 ATATAATTTCATTTCTCTGTTGG + Intergenic
1154260799 18:12830717-12830739 ATTCCATTGTATTTCTATCTTGG + Intronic
1155116198 18:22770304-22770326 ATTCAAATGCATTTCTAGGGAGG - Intergenic
1155333654 18:24743188-24743210 ATTCATTTACATTTGTTTGTAGG + Intergenic
1155376714 18:25166639-25166661 ATTCAAATCTTTTCCTATGTAGG + Intronic
1156170429 18:34477453-34477475 AGACAATTCCAATTTTATGTTGG + Intergenic
1157073958 18:44444282-44444304 ATTGAATAGCATTTCCATGTAGG + Intergenic
1164081181 19:21862740-21862762 TTTCAAAACCTTTTCTATGTGGG + Intergenic
925209444 2:2033965-2033987 ATTCAAGTGCATTTATTTGTCGG - Intronic
926411076 2:12603616-12603638 TTTCAATTTCATTTTTATGTGGG - Intergenic
926495232 2:13578178-13578200 ATTCAATTGCATATCAATGATGG + Intergenic
927413136 2:22849314-22849336 ATTAAAGCCCATTTCTATCTTGG + Intergenic
928218940 2:29386622-29386644 AATGATTTCCATTTCTATATTGG + Intronic
928238135 2:29563162-29563184 ATTCATTTCAAATTCAATGTAGG + Intronic
929334812 2:40729065-40729087 ATCTATTTCCATTTCTATGTAGG + Intergenic
929345533 2:40879091-40879113 ACTCATTTTCATTGCTATGTAGG + Intergenic
930132170 2:47863336-47863358 ATTTAATTCTGTTTCTCTGTTGG - Intronic
930353691 2:50290733-50290755 ACCAAATTCCATTTCTATGTTGG - Intronic
933022614 2:77213439-77213461 AATCAATGACATTTCTATGAGGG - Intronic
933733173 2:85473480-85473502 ATTCCATCCCATTTCTAGGCAGG + Intergenic
935349402 2:102140851-102140873 TTCCAATTCCATTTCTGTGTTGG + Intronic
935516268 2:104043524-104043546 AGGCAATTTGATTTCTATGTGGG + Intergenic
935841125 2:107111646-107111668 ATTCAATTCCAAAATTATGTAGG - Intergenic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
936914863 2:117629997-117630019 ATCCGATTCCATTTTTATCTTGG + Intergenic
939895672 2:147788210-147788232 ATTTAAATCCATTTATATCTAGG - Intergenic
940078635 2:149773791-149773813 ATTTAATTACATTTCTTTTTTGG + Intergenic
941572065 2:167182960-167182982 ATTCACTCCCTTTTCTATTTTGG - Intronic
942339501 2:174928954-174928976 AGTCACTTCCAACTCTATGTAGG - Intronic
942366002 2:175228470-175228492 AGTCAATTCCATTCATATTTGGG + Intergenic
942367991 2:175249341-175249363 TTTCAACTGCATTTCAATGTTGG - Intergenic
942422246 2:175820291-175820313 ATTCTATTCCATTTCTATACAGG - Intergenic
943085251 2:183303095-183303117 AATCAATTCGATATCTATATGGG + Intergenic
945474997 2:210271469-210271491 AGTTAATTCCCTTTCTATCTGGG + Intergenic
945647772 2:212521703-212521725 ATTCAATTCCCTTTTTAGATGGG + Intronic
945979376 2:216296729-216296751 TTTCAATTCTTTCTCTATGTGGG + Intronic
947908740 2:233786938-233786960 AATCATTTTCATTCCTATGTAGG + Intronic
1169506733 20:6219747-6219769 ATCCAGGGCCATTTCTATGTTGG - Intergenic
1170093647 20:12621040-12621062 ATTCCATTCCCTTTTTATTTGGG + Intergenic
1170260886 20:14406863-14406885 ATTAAGTTTCATTTCTTTGTAGG + Intronic
1174724156 20:52843824-52843846 ATTGAGTTCCATTTCCAAGTTGG - Intergenic
1174999954 20:55616507-55616529 CTTCAACTCCATTTTTATGGTGG + Intergenic
1176402223 21:6323924-6323946 AGTCAACACCATTGCTATGTCGG - Intergenic
1176434934 21:6665180-6665202 AGTCAACACCATTGCTATGTCGG + Intergenic
1176459196 21:6992250-6992272 AGTCAACACCATTGCTATGTCGG + Intergenic
1176610652 21:8883630-8883652 ATTCTATTCCATGTCTATACTGG + Intergenic
1177600216 21:23301535-23301557 ATTAAATTCCATTTATAGATAGG + Intergenic
1178388096 21:32172761-32172783 ATTCTATTCCATTGATATTTTGG - Intergenic
1178505660 21:33160981-33161003 ATTTGCTTCCATTTCTATGAAGG + Intergenic
1183024809 22:35057180-35057202 ATTCTATTCCATTGGTCTGTGGG - Intergenic
1183290180 22:36996958-36996980 TTTCAATTCCTTCTTTATGTGGG - Intronic
1184237892 22:43195003-43195025 ATTCTATTCCATTGATCTGTAGG + Intergenic
1184302940 22:43573286-43573308 ATTCAATTTCATTTCTATATGGG + Intronic
1184953299 22:47861651-47861673 TTGCAATTCCTTTGCTATGTAGG + Intergenic
949571261 3:5295544-5295566 ATTCTCTTCCATATCTCTGTAGG + Intergenic
949809836 3:7994790-7994812 CTTCAATTTCAATTCTATGAAGG + Intergenic
949854091 3:8444189-8444211 ATTCAATTACAGTCCTTTGTGGG + Intergenic
950711302 3:14814643-14814665 CTTAAATTCCATCTCTATGATGG + Intergenic
951931343 3:27970540-27970562 AGACAGTTCCATTTCTATATTGG - Intergenic
952096740 3:29962918-29962940 ATCTATTTCCAGTTCTATGTAGG - Intronic
957368118 3:79253108-79253130 ATTGAATTTCATTTTTATTTTGG - Intronic
957590274 3:82188011-82188033 AATTAATCCCATTTCTTTGTTGG + Intergenic
958494539 3:94828018-94828040 ATTCAATTCAATTTTTAGGTAGG + Intergenic
958932091 3:100217953-100217975 AGACAATTGCATTGCTATGTAGG - Intergenic
959046503 3:101480323-101480345 ATTCTGTTCCATTGCTCTGTGGG - Intronic
959207573 3:103330295-103330317 CTTCAATTCCTTCTCTATATTGG - Intergenic
959516175 3:107269553-107269575 TTTCAAGTCCATTTCAGTGTTGG + Intergenic
959599716 3:108167813-108167835 ATTCAATTCCACTTCTGTGCTGG + Exonic
959633953 3:108540577-108540599 ATAAAATTCCATTTCCATTTTGG + Intergenic
960684472 3:120283416-120283438 ATTTTATTCCATTCTTATGTAGG - Intronic
960868816 3:122229317-122229339 GTTCATTTGCATTTCTATTTAGG + Intronic
960871880 3:122258327-122258349 ATAAATTTACATTTCTATGTTGG + Intronic
961975537 3:131020917-131020939 ATTCAGTTGGATTTCCATGTGGG + Intronic
963577105 3:147074914-147074936 ATTAAATTCCATATTTATTTCGG + Intergenic
963825842 3:149952433-149952455 ATTTAATTTCCTTTATATGTAGG + Intronic
963874928 3:150464447-150464469 ATTTAATTCTATTTCAATTTAGG + Exonic
965359417 3:167719377-167719399 ATTTAATTCCTTTTCTATAATGG - Intronic
965421817 3:168469178-168469200 ATTCAATTCCCTTTTTATTGTGG + Intergenic
966358912 3:179112847-179112869 ATTTAATGCCATTTTTAGGTGGG - Intergenic
1202737335 3_GL000221v1_random:18416-18438 ATTCTATTCCATGTCTATACTGG + Intergenic
969085722 4:4655013-4655035 AGTCAATTGAATGTCTATGTGGG - Intergenic
972055176 4:34793104-34793126 TTTCACTTCCATTTTTTTGTTGG + Intergenic
973117043 4:46474657-46474679 ATTAAATGCCATTACTATGTTGG - Intronic
973312466 4:48724313-48724335 ACTCAAGTCTATTTCCATGTTGG + Intronic
974270873 4:59650438-59650460 CATCAATTCCATTTATATGCTGG - Intergenic
974719566 4:65720155-65720177 ATGCAATTTCTTTTCTATGTTGG + Intergenic
975786525 4:77895012-77895034 ATTCTCTTCTATTTCAATGTAGG - Intronic
976520923 4:86025366-86025388 ATTCAAGTCTATTTTCATGTAGG + Intronic
977332489 4:95654964-95654986 ATTCAATTCTATTTCTATCAAGG - Intergenic
977435276 4:96987577-96987599 ATGTACTTCCATTTCTATCTAGG - Intergenic
978943329 4:114464202-114464224 AATCACTTCCATCTCTATTTTGG + Intergenic
980592484 4:134908710-134908732 ATTCCATTCCACTTCAATGGAGG + Intergenic
981764929 4:148238415-148238437 CTTCAGGTCCATTTCTGTGTTGG - Intronic
982154243 4:152500052-152500074 ATTCAATTGCTTTTGTCTGTAGG - Intronic
983016440 4:162618927-162618949 TTTCAATTCTATTTCTAACTAGG + Intergenic
983282392 4:165697087-165697109 TTCCAATCCCATTGCTATGTGGG + Intergenic
983325055 4:166243759-166243781 ATTCTGTTCCATTTATATATGGG + Intergenic
983573437 4:169234771-169234793 ATTGATTTCTATTTCTAAGTCGG + Intronic
983575847 4:169260921-169260943 ATTTAATTTCATTTCTATTTGGG - Intronic
984076714 4:175190819-175190841 TTTCAGTTTCATTTCTCTGTTGG - Intergenic
984399271 4:179240967-179240989 ATTAAATTCCACTTCTCAGTGGG - Intergenic
986216381 5:5723183-5723205 AGTCAATTCCAATTCACTGTGGG - Intergenic
986370152 5:7072125-7072147 CTTCGATTCCATTTCTTTGCAGG - Intergenic
986570928 5:9165303-9165325 ATTCGTTTCCTTTTCTTTGTGGG - Intronic
986897897 5:12393143-12393165 ATTCAGTTCCTTTTCATTGTGGG + Intergenic
991191019 5:63873823-63873845 ACATAGTTCCATTTCTATGTGGG - Intergenic
993035835 5:82756290-82756312 AGTCAACTCCATTGCTCTGTGGG + Intergenic
994491322 5:100447935-100447957 ATTTAATTCCATTGCTATTTAGG - Intergenic
994753984 5:103772469-103772491 TTTCAAATCCATTTCCCTGTTGG + Intergenic
995350601 5:111170716-111170738 TTGCAATTCCATTTCTATGAAGG + Intergenic
995352630 5:111198166-111198188 ATTCAATTTTTTTTCTATTTTGG - Intergenic
995942922 5:117607028-117607050 ATCCAATTTCATTTTTAAGTAGG - Intergenic
996332442 5:122345486-122345508 ATTCTATCCCAGTTCTTTGTTGG + Intronic
997742589 5:136270076-136270098 AATCAAGTCCATTTCAAGGTCGG + Intronic
998550866 5:143076997-143077019 ATGCAATTCCATTCCTAGGTAGG - Intronic
998553317 5:143098769-143098791 ATTAAATTCATTTTCTATGAGGG - Intronic
999031653 5:148299869-148299891 CTCCAATTCCAGTTTTATGTAGG - Intergenic
1000453042 5:161414568-161414590 ATAGAATTCCATGTATATGTAGG - Intronic
1004258614 6:14087895-14087917 ATTTTATTCCATTTATATTTTGG + Intergenic
1004844527 6:19625117-19625139 ATACACTTTCATTTGTATGTGGG + Intergenic
1007806159 6:44449769-44449791 ATTCAAATGCATTTCTAGGGAGG - Exonic
1008899760 6:56597691-56597713 GTTCAATTCTATTTCCAGGTTGG - Intronic
1008923632 6:56868988-56869010 GTATAATTTCATTTCTATGTAGG - Intronic
1009290360 6:61872691-61872713 TATCAATTCTATTTTTATGTGGG + Intronic
1010769336 6:79810780-79810802 ATTTACTGCAATTTCTATGTTGG - Intergenic
1012857199 6:104516529-104516551 ACAAAATTCGATTTCTATGTGGG - Intergenic
1013447502 6:110245618-110245640 ATATAATTTCATTTCAATGTTGG + Intronic
1014695449 6:124615037-124615059 ATTCCATTTCATTTATCTGTTGG + Intronic
1014984808 6:127991391-127991413 ATTCAAATTAATTTCTTTGTAGG - Exonic
1015695698 6:135977312-135977334 TTTCAATCCCATTTCTCTGGAGG - Intronic
1016445147 6:144124297-144124319 ATTAAATTGAATTTGTATGTAGG - Intergenic
1017637614 6:156458148-156458170 ATTCAATTCCATTCCTTTAAAGG - Intergenic
1019083635 6:169454234-169454256 ATTCAAAACCATTTGCATGTTGG + Intergenic
1020090277 7:5334924-5334946 ACTCTATTTCTTTTCTATGTGGG - Intronic
1020657608 7:10945916-10945938 ATTCAATTCCCCTTCTTTTTTGG - Intergenic
1020902678 7:14025367-14025389 ATTTCCTTCCATTTCTGTGTTGG - Intergenic
1021468399 7:20971937-20971959 ATTAAATGCCATTGATATGTAGG - Intergenic
1022985260 7:35647717-35647739 ATTCAAATCCATTTTTAACTTGG - Intronic
1023372490 7:39525912-39525934 ATTTTATTCCATTTGTGTGTTGG - Intergenic
1024034789 7:45498095-45498117 ATGCAATTGCTTTTCCATGTGGG + Intergenic
1024319033 7:48046909-48046931 ATAAAATTCCTTTTCTATATTGG - Intronic
1024392050 7:48826691-48826713 ATTTAATTCCATTTATATACAGG + Intergenic
1027345970 7:77260002-77260024 TTTCTTTTCCATTTCTCTGTAGG - Exonic
1027676215 7:81161697-81161719 ATTGAATTCCTTTTCTAAGATGG - Intergenic
1027734587 7:81916549-81916571 ATTCAATGCCATTTGTAATTGGG - Intergenic
1028195463 7:87902350-87902372 ATTCAATTCCACTTGTATCAAGG + Intronic
1030375887 7:108753244-108753266 ATTGAATTCTATTTCTTTGAGGG - Intergenic
1031185068 7:118467392-118467414 CTTATATTACATTTCTATGTAGG + Intergenic
1031754440 7:125619915-125619937 TTTAAATACCATTTATATGTTGG - Intergenic
1034247537 7:149659184-149659206 CTTCCATTCCATTTCTAATTGGG + Intergenic
1034854357 7:154527652-154527674 ATTAAAATCTATTACTATGTAGG + Intronic
1038097259 8:24328380-24328402 TGTTAATTCCATTTCTATCTAGG - Intronic
1038273814 8:26101832-26101854 ATTCAATTTCTTTTATATATAGG - Intergenic
1039073109 8:33663914-33663936 ATTCAATTCCATGTGATTGTTGG - Intergenic
1040435400 8:47386132-47386154 ATGCAATCTTATTTCTATGTAGG + Intronic
1042025740 8:64421853-64421875 ATACAATTCCATTCCTATGAAGG + Intergenic
1042468626 8:69158262-69158284 ATCTAATACCATTTCTTTGTAGG + Intergenic
1043312783 8:78882588-78882610 ATTTAAATTCATATCTATGTGGG + Intergenic
1043823499 8:84897048-84897070 ATTCAATTCCATTTCTATGTAGG - Intronic
1044547798 8:93478911-93478933 ATTGAATTCCTTTTAAATGTAGG + Intergenic
1044604014 8:94033313-94033335 ATTCTATTCCTTTACTAAGTGGG + Intergenic
1044757955 8:95485995-95486017 TTTCAAATCCATTTCCATATTGG + Intergenic
1046228077 8:111312832-111312854 ATGCTCTTCCATTTCTGTGTAGG - Intergenic
1046865716 8:119148126-119148148 TTTCAATGTAATTTCTATGTAGG - Intergenic
1046970013 8:120212464-120212486 ACTCAATTCAATATCTGTGTGGG - Exonic
1046991081 8:120454693-120454715 ATTCAGTTATTTTTCTATGTGGG - Intronic
1047059929 8:121213968-121213990 ATTCAGTGCCACTTCTAAGTGGG - Intergenic
1048731503 8:137446620-137446642 ATTCTATTCCATTTCTTTCAAGG - Intergenic
1050973119 9:11902509-11902531 ATTCATTACCTTTTCTATGTTGG + Intergenic
1051117054 9:13707831-13707853 TTTCAGTTCCCTTTCCATGTGGG - Intergenic
1051798419 9:20902969-20902991 TTTCAATTCTATTTTTATTTGGG + Intronic
1052567237 9:30170872-30170894 TTTCAATTTCTTTTCTATGTTGG + Intergenic
1053399259 9:37802649-37802671 ACTCTATTCCATTTCAATGATGG + Intronic
1055047968 9:71950224-71950246 ATTCAAATCCCTTACAATGTTGG - Intronic
1056334992 9:85559656-85559678 GGTCAATTCCAGTGCTATGTTGG - Intronic
1059131828 9:111759974-111759996 AATCAATTCCATGTCTAAGGAGG + Intronic
1059879189 9:118671028-118671050 ATTTAGTTCCTTTTATATGTTGG + Intergenic
1203436602 Un_GL000195v1:143467-143489 AGTCAACACCATTGCTATGTCGG - Intergenic
1203725944 Un_GL000216v2:49608-49630 ATTCAATTCCATTCCTTTCGAGG + Intergenic
1203508765 Un_KI270741v1:95260-95282 ATTCAATAACACTGCTATGTGGG - Intergenic
1203706058 Un_KI270742v1:48866-48888 ATTCTATTCCATGTCTATACTGG + Intergenic
1185695970 X:2194926-2194948 ATTCATTTCCATTTTTTTGAAGG + Intergenic
1186195129 X:7103209-7103231 ATTCTATTCTATTAGTATGTAGG - Intronic
1187685470 X:21811601-21811623 ATTCCTATCCATTTCTATGTAGG + Intergenic
1189864242 X:45307778-45307800 ATATGATTCCATTTTTATGTAGG + Intergenic
1192083387 X:68070133-68070155 ATGAAATTCCATTTGTAGGTAGG - Intronic
1192743831 X:73919124-73919146 ATTCAATGCCTTTCATATGTAGG - Intergenic
1193967979 X:88012570-88012592 ATTCAAATGCATTTCAATGAAGG + Intergenic
1195617608 X:106925409-106925431 ATTCTGTTCTATTTCTATTTGGG + Intronic
1195969942 X:110462318-110462340 ATACAATTGCATTTCTGTGATGG + Intergenic
1196151236 X:112376773-112376795 ATTCATTTCCATTCCTATCAAGG + Intergenic
1197034476 X:121857708-121857730 ATTTTATTCCATATTTATGTTGG + Intergenic
1197375059 X:125672937-125672959 TTTCAAGTCCATGTCTATATTGG + Intergenic
1197714034 X:129693430-129693452 CTGCAATTCCATTTCTTGGTAGG - Intergenic
1197825534 X:130586398-130586420 GTTCACTTCCATTGCTATATTGG - Intergenic
1198397816 X:136239748-136239770 ACACAATTTCATTTATATGTTGG + Intronic
1201420299 Y:13791350-13791372 ATGCATTTTCATTTCTTTGTAGG + Intergenic
1202045082 Y:20729709-20729731 GTTCAAGTCCTTTTCTCTGTGGG + Intergenic