ID: 1043823639

View in Genome Browser
Species Human (GRCh38)
Location 8:84898870-84898892
Sequence GTGTCCTAACAGAGGTTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 100}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043823639 Original CRISPR GTGTCCTAACAGAGGTTTGC AGG (reversed) Intronic
903867681 1:26410901-26410923 GTGTCCAACCAGCAGTTTGCAGG + Exonic
912748998 1:112269973-112269995 GTGTCCTCACAGACTTCTGCTGG - Intergenic
916118315 1:161506647-161506669 GTTTACAGACAGAGGTTTGCAGG + Intronic
916620018 1:166487072-166487094 GTGTCCAAACAGAGGCCTGGAGG + Intergenic
917717371 1:177752053-177752075 GTGTCTTACCTGAGGTTGGCTGG + Intergenic
922029308 1:221782672-221782694 GTGGCCTCTCAGAGGTTTCCTGG - Intergenic
924722791 1:246638800-246638822 GTGTCCACACAGAAGTGTGCAGG + Intronic
1069962420 10:72087017-72087039 GGGTCCTAGAAGAGGTTTTCTGG + Intronic
1070450217 10:76550509-76550531 GAGCCCTAACAGAGGTTTTGGGG + Intronic
1070661753 10:78311527-78311549 GTGTCCTAACTGATGATTCCTGG + Intergenic
1070722565 10:78766802-78766824 GTGTCCTAACTGATGATTCCTGG - Intergenic
1071073568 10:81725216-81725238 GTGTCCTATCAGAGGGTGGAGGG - Intergenic
1071743537 10:88389293-88389315 GTCTCCTAACAGAACTGTGCTGG + Intronic
1073553479 10:104425718-104425740 GTGTCCTAGCTGAGGTTGGTTGG + Intronic
1076786887 10:132754353-132754375 GTCTCCTGACAGAGGTGTCCTGG - Intronic
1077558091 11:3236514-3236536 GTTTTCTAAAAGAGTTTTGCAGG - Intergenic
1084317573 11:68354332-68354354 GTTTCATAACAGAGGCCTGCTGG - Intronic
1091088436 11:132746401-132746423 GTCTCCTCACAGAGCTTTGTGGG - Intronic
1091651468 12:2313424-2313446 GTGTCCTACCAGAGGGCTCCAGG - Intronic
1096151332 12:49314996-49315018 GTGGCCTATCAGGGGTTTTCAGG - Intergenic
1096523585 12:52197876-52197898 GTGTGCTCACAGAGCTGTGCAGG - Intergenic
1099201536 12:79683540-79683562 GTGTCCTAAAAGATGTTTCTGGG - Intronic
1099598981 12:84707330-84707352 GTGTCCTAAAGTAGGTTTTCTGG - Intergenic
1100076987 12:90797310-90797332 GTGTCCCAGCATAGCTTTGCTGG + Intergenic
1103036636 12:117662259-117662281 GTGTCTTGACAGAAGTTTGCTGG - Intronic
1103733646 12:123044654-123044676 GTGTCCTGTCAGAGTTTTGAAGG - Intronic
1108523007 13:51261702-51261724 GTTTCCTAAGGGAGGTTTGGTGG + Intronic
1112729712 13:102347348-102347370 GTGTCCTAAAGGAGATATGCAGG + Intronic
1114412380 14:22513220-22513242 GAGTCCAAACAGAGGTTACCAGG - Intergenic
1115122004 14:29948502-29948524 GTGTCCAGGCAGAAGTTTGCTGG - Intronic
1116941868 14:50798582-50798604 GCATCCTAACAGAGATCTGCTGG - Intronic
1118054173 14:62062183-62062205 GTGACAAAACAGATGTTTGCAGG + Intronic
1118559018 14:67057434-67057456 GGGTCCTGTCAGAGGGTTGCAGG + Intronic
1121137524 14:91511488-91511510 GTATCCCAACAGAGACTTGCTGG - Intergenic
1121174281 14:91879168-91879190 GTTTCCTAAAAGAAGTTTGGAGG + Intronic
1126245689 15:46502261-46502283 GGGGCCTACCAGAGGTTTGAGGG + Intergenic
1127841840 15:62838528-62838550 GTGTGTTAACAGAGGCATGCCGG - Intronic
1129604511 15:77018336-77018358 GTGTTCTGACAGAGTTTGGCTGG - Intronic
1141708025 16:85680029-85680051 GAGGGCTCACAGAGGTTTGCTGG - Intronic
1146503778 17:33386972-33386994 GTGTTTTGACAGAGTTTTGCTGG + Intronic
1149034343 17:52116921-52116943 GTGTCTTAATTGAGGTTTGTTGG + Intronic
1150876150 17:68972672-68972694 GTGTCCGAAGAGGGGTTTGGAGG + Intergenic
1153441005 18:5119009-5119031 GTTTCCTCAGAGATGTTTGCTGG + Intergenic
1154250182 18:12737790-12737812 GTTTCCTAACAGACATTTGGTGG - Intergenic
1154417670 18:14191100-14191122 GTGTCCTAGCACAGATCTGCTGG + Intergenic
1155080628 18:22406706-22406728 ATGTCCTTGCAAAGGTTTGCTGG - Intergenic
1157273986 18:46297248-46297270 GGGTCCTCCAAGAGGTTTGCTGG - Intergenic
929420555 2:41785629-41785651 GGGTCCTATCAGGGGTATGCAGG - Intergenic
934614567 2:95763151-95763173 GTGGCCCCACAGAGGTCTGCAGG - Intergenic
934839740 2:97617430-97617452 GTGGCCCCACAGAGGTCTGCAGG + Intergenic
934853524 2:97715619-97715641 GTCTCCTAATAGACATTTGCTGG + Intronic
935043550 2:99458177-99458199 TTGTCATAAAAGTGGTTTGCAGG - Intronic
944282483 2:197913764-197913786 GTGTCCAACCATAGGTTTGGAGG - Intronic
946045785 2:216819883-216819905 CTGTCTTAACTGAGTTTTGCAGG + Intergenic
946114082 2:217446404-217446426 GTGTCCTAGCACAGGTTTGCAGG - Intronic
949067250 2:241999541-241999563 GTGTGCTACCAGAGGGTGGCAGG + Intergenic
1171248677 20:23633021-23633043 GTGTCCTCCCAGAGTTTTACAGG - Intronic
1173650684 20:44662320-44662342 GTGTGGTAATAGAGGTTGGCAGG + Intergenic
1174775044 20:53335539-53335561 TTTTCCTAACAGAAGTTTGTGGG - Intronic
1177816889 21:25987475-25987497 GTCTCCTAACAGAGCCTTGAGGG + Intronic
1179667149 21:42920791-42920813 GTGTCCACACAGAAGTGTGCAGG + Intergenic
1183035742 22:35139691-35139713 GTTCCATAACAGAGGTTTTCTGG - Intergenic
1183865613 22:40701906-40701928 GTATCCTCACAGAAGTGTGCAGG - Intergenic
955945792 3:64192231-64192253 ATCTCTTAACAGATGTTTGCTGG + Intronic
956351642 3:68343565-68343587 GTGATCTCACAGAGGTTTGCAGG + Intronic
960304675 3:116046494-116046516 GTGTGCTAACAGATGTCTGAGGG - Intronic
963878319 3:150501182-150501204 ATGTCCAAGCAGAAGTTTGCTGG - Intergenic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
976626260 4:87186431-87186453 GAGTGCTAACTGATGTTTGCTGG - Intronic
976661962 4:87548973-87548995 GTGTCCTAGCAGAAGTAAGCAGG - Intergenic
985839824 5:2298025-2298047 GTGTCCCCACAGTGGTCTGCAGG + Intergenic
985910123 5:2872772-2872794 GTGTTTTAACAGTGCTTTGCAGG + Intergenic
986338603 5:6772412-6772434 GTGTCCTCTCTGAGGTTTCCAGG + Intergenic
990340804 5:54821192-54821214 ATGCCCTGAAAGAGGTTTGCAGG + Intergenic
994580852 5:101639706-101639728 TTGTCCTAACAGAGTTTGTCAGG - Intergenic
995272291 5:110235510-110235532 GTTTCCTAACATAGGGGTGCAGG - Intergenic
1001943592 5:175758744-175758766 GTTTCCTAACTTATGTTTGCTGG + Intergenic
1003121997 6:3325899-3325921 GCGTCGTATCAGTGGTTTGCTGG + Intronic
1003347913 6:5287744-5287766 GTGTACTAACAGTGTTTTTCTGG - Intronic
1005398848 6:25410999-25411021 GTGTTCTAAAAGAGGCTGGCTGG + Intronic
1006299392 6:33185632-33185654 GTGTCCTAGGAGATGATTGCTGG + Intronic
1007965224 6:45998286-45998308 GTGTCCTAACATCTGTGTGCTGG - Intronic
1011077052 6:83448580-83448602 GAGTCCTTACACAGGTTTGAGGG + Intergenic
1013640573 6:112074071-112074093 GTCTCCTTACAGAGTTTGGCAGG + Intronic
1015164612 6:130189701-130189723 GTCTCCTAGCAGAGTTCTGCTGG + Intronic
1016252068 6:142055634-142055656 TTGTCCTAACAGAGCTGTGGGGG - Intergenic
1022962805 7:35445896-35445918 GTGTCCTTTCAGTGGCTTGCTGG - Intergenic
1024914374 7:54483010-54483032 TTGTCCTAACAGAGGAGTCCCGG + Intergenic
1026778194 7:73245041-73245063 GCGTCCTGGCAGCGGTTTGCTGG - Intergenic
1027068981 7:75147502-75147524 GCGTCCTGGCAGCGGTTTGCTGG + Intronic
1032433059 7:131878644-131878666 CTGTCCTCACAGAAGTTTGGGGG - Intergenic
1034342039 7:150363707-150363729 GTGTCTTCACAGAGGATTTCTGG + Intergenic
1035270550 7:157717361-157717383 GTGTCCAAGCTGATGTTTGCAGG - Intronic
1036599786 8:10249690-10249712 ATGGCCCAACAGAGGTCTGCTGG - Intronic
1036752270 8:11450869-11450891 GTGTCCAGACATAGGTGTGCAGG + Intronic
1036957668 8:13206794-13206816 GTTACCATACAGAGGTTTGCTGG + Intronic
1039040553 8:33403955-33403977 GTGTCCTGCCACAGCTTTGCAGG - Intronic
1039327357 8:36500236-36500258 CTGTCTTATCAGAGGTTTGTGGG - Intergenic
1043823639 8:84898870-84898892 GTGTCCTAACAGAGGTTTGCAGG - Intronic
1048892801 8:138963019-138963041 GTGTATTAACAGAGTTTTGCAGG + Intergenic
1050365926 9:4873715-4873737 GGGTCCTAACAGAACTTGGCTGG - Intronic
1058645145 9:107124977-107124999 GTGTTCTAACAGAGGAGAGCAGG + Intergenic
1060424338 9:123492235-123492257 GTGTCAGGACAGAGGCTTGCTGG + Intronic
1187344813 X:18453399-18453421 TTGTCCTAATAAATGTTTGCTGG - Intronic
1197780434 X:130153726-130153748 GTGTCCTCACATGGTTTTGCGGG - Intronic
1201905888 Y:19085255-19085277 GAGTCTTTACAGAGGTTTGAGGG + Intergenic