ID: 1043826342

View in Genome Browser
Species Human (GRCh38)
Location 8:84933822-84933844
Sequence TGCTATATCCCTAATGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043826342_1043826347 8 Left 1043826342 8:84933822-84933844 CCCTCCCCATTAGGGATATAGCA No data
Right 1043826347 8:84933853-84933875 CTCCCAATTAGATAGTGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043826342 Original CRISPR TGCTATATCCCTAATGGGGA GGG (reversed) Intergenic
No off target data available for this crispr