ID: 1043826347

View in Genome Browser
Species Human (GRCh38)
Location 8:84933853-84933875
Sequence CTCCCAATTAGATAGTGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043826342_1043826347 8 Left 1043826342 8:84933822-84933844 CCCTCCCCATTAGGGATATAGCA No data
Right 1043826347 8:84933853-84933875 CTCCCAATTAGATAGTGTCATGG No data
1043826344_1043826347 4 Left 1043826344 8:84933826-84933848 CCCCATTAGGGATATAGCAAACA No data
Right 1043826347 8:84933853-84933875 CTCCCAATTAGATAGTGTCATGG No data
1043826346_1043826347 2 Left 1043826346 8:84933828-84933850 CCATTAGGGATATAGCAAACAGT No data
Right 1043826347 8:84933853-84933875 CTCCCAATTAGATAGTGTCATGG No data
1043826345_1043826347 3 Left 1043826345 8:84933827-84933849 CCCATTAGGGATATAGCAAACAG No data
Right 1043826347 8:84933853-84933875 CTCCCAATTAGATAGTGTCATGG No data
1043826343_1043826347 7 Left 1043826343 8:84933823-84933845 CCTCCCCATTAGGGATATAGCAA No data
Right 1043826347 8:84933853-84933875 CTCCCAATTAGATAGTGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043826347 Original CRISPR CTCCCAATTAGATAGTGTCA TGG Intergenic
No off target data available for this crispr