ID: 1043827090

View in Genome Browser
Species Human (GRCh38)
Location 8:84942282-84942304
Sequence ATGTCCTTCTAAAGGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043827090_1043827097 29 Left 1043827090 8:84942282-84942304 CCTTCACTCCTTTAGAAGGACAT No data
Right 1043827097 8:84942334-84942356 GAGTAAAAGAAGCAATGATTGGG No data
1043827090_1043827093 2 Left 1043827090 8:84942282-84942304 CCTTCACTCCTTTAGAAGGACAT No data
Right 1043827093 8:84942307-84942329 TTTGTTAGGTCCTTTTTCCATGG 0: 39
1: 40
2: 27
3: 29
4: 254
1043827090_1043827096 28 Left 1043827090 8:84942282-84942304 CCTTCACTCCTTTAGAAGGACAT No data
Right 1043827096 8:84942333-84942355 AGAGTAAAAGAAGCAATGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043827090 Original CRISPR ATGTCCTTCTAAAGGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr