ID: 1043829932

View in Genome Browser
Species Human (GRCh38)
Location 8:84975719-84975741
Sequence TTTGTGTTGCCACCAAATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043829932_1043829933 -2 Left 1043829932 8:84975719-84975741 CCAGGATTTGGTGGCAACACAAA No data
Right 1043829933 8:84975740-84975762 AATGTCTGTGAACAGATGAATGG 0: 2
1: 14
2: 139
3: 813
4: 3316
1043829932_1043829934 29 Left 1043829932 8:84975719-84975741 CCAGGATTTGGTGGCAACACAAA No data
Right 1043829934 8:84975771-84975793 AATGTTGTACATATACACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043829932 Original CRISPR TTTGTGTTGCCACCAAATCC TGG (reversed) Intergenic
No off target data available for this crispr