ID: 1043836059

View in Genome Browser
Species Human (GRCh38)
Location 8:85047851-85047873
Sequence CTTTATAAGTAGTAGGATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043836059_1043836061 6 Left 1043836059 8:85047851-85047873 CCAGTATCCTACTACTTATAAAG No data
Right 1043836061 8:85047880-85047902 AATAACTTTATATCTACAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043836059 Original CRISPR CTTTATAAGTAGTAGGATAC TGG (reversed) Intergenic
No off target data available for this crispr