ID: 1043836649

View in Genome Browser
Species Human (GRCh38)
Location 8:85055076-85055098
Sequence CCTTCAGCTTTTGAGATGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043836649_1043836653 15 Left 1043836649 8:85055076-85055098 CCAAACATCTCAAAAGCTGAAGG No data
Right 1043836653 8:85055114-85055136 CCTTCTCAAGACTCTACTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043836649 Original CRISPR CCTTCAGCTTTTGAGATGTT TGG (reversed) Intergenic