ID: 1043836653

View in Genome Browser
Species Human (GRCh38)
Location 8:85055114-85055136
Sequence CCTTCTCAAGACTCTACTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043836649_1043836653 15 Left 1043836649 8:85055076-85055098 CCAAACATCTCAAAAGCTGAAGG No data
Right 1043836653 8:85055114-85055136 CCTTCTCAAGACTCTACTGTAGG No data
1043836647_1043836653 17 Left 1043836647 8:85055074-85055096 CCCCAAACATCTCAAAAGCTGAA No data
Right 1043836653 8:85055114-85055136 CCTTCTCAAGACTCTACTGTAGG No data
1043836648_1043836653 16 Left 1043836648 8:85055075-85055097 CCCAAACATCTCAAAAGCTGAAG No data
Right 1043836653 8:85055114-85055136 CCTTCTCAAGACTCTACTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043836653 Original CRISPR CCTTCTCAAGACTCTACTGT AGG Intergenic