ID: 1043837326

View in Genome Browser
Species Human (GRCh38)
Location 8:85062729-85062751
Sequence GAAACCAGTCAGAATCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043837326_1043837329 15 Left 1043837326 8:85062729-85062751 CCATCTTGATTCTGACTGGTTTC No data
Right 1043837329 8:85062767-85062789 ATCATTTTGTTTTATCAGCAGGG No data
1043837326_1043837328 14 Left 1043837326 8:85062729-85062751 CCATCTTGATTCTGACTGGTTTC No data
Right 1043837328 8:85062766-85062788 CATCATTTTGTTTTATCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043837326 Original CRISPR GAAACCAGTCAGAATCAAGA TGG (reversed) Intergenic
No off target data available for this crispr