ID: 1043837329

View in Genome Browser
Species Human (GRCh38)
Location 8:85062767-85062789
Sequence ATCATTTTGTTTTATCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043837326_1043837329 15 Left 1043837326 8:85062729-85062751 CCATCTTGATTCTGACTGGTTTC No data
Right 1043837329 8:85062767-85062789 ATCATTTTGTTTTATCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043837329 Original CRISPR ATCATTTTGTTTTATCAGCA GGG Intergenic
No off target data available for this crispr