ID: 1043845820

View in Genome Browser
Species Human (GRCh38)
Location 8:85162365-85162387
Sequence TGATCCCCACACATCGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043845820_1043845823 1 Left 1043845820 8:85162365-85162387 CCTCCCTCGATGTGTGGGGATCA No data
Right 1043845823 8:85162389-85162411 GATTTGAGATGAGATTTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043845820 Original CRISPR TGATCCCCACACATCGAGGG AGG (reversed) Intergenic
No off target data available for this crispr