ID: 1043845823

View in Genome Browser
Species Human (GRCh38)
Location 8:85162389-85162411
Sequence GATTTGAGATGAGATTTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043845819_1043845823 2 Left 1043845819 8:85162364-85162386 CCCTCCCTCGATGTGTGGGGATC No data
Right 1043845823 8:85162389-85162411 GATTTGAGATGAGATTTGAGTGG No data
1043845820_1043845823 1 Left 1043845820 8:85162365-85162387 CCTCCCTCGATGTGTGGGGATCA No data
Right 1043845823 8:85162389-85162411 GATTTGAGATGAGATTTGAGTGG No data
1043845813_1043845823 12 Left 1043845813 8:85162354-85162376 CCCACCAGGTCCCTCCCTCGATG No data
Right 1043845823 8:85162389-85162411 GATTTGAGATGAGATTTGAGTGG No data
1043845809_1043845823 29 Left 1043845809 8:85162337-85162359 CCATGATCCAATCACCTCCCACC 0: 1936
1: 4532
2: 7496
3: 10022
4: 10633
Right 1043845823 8:85162389-85162411 GATTTGAGATGAGATTTGAGTGG No data
1043845811_1043845823 22 Left 1043845811 8:85162344-85162366 CCAATCACCTCCCACCAGGTCCC 0: 642
1: 2594
2: 4637
3: 4908
4: 4635
Right 1043845823 8:85162389-85162411 GATTTGAGATGAGATTTGAGTGG No data
1043845814_1043845823 11 Left 1043845814 8:85162355-85162377 CCACCAGGTCCCTCCCTCGATGT No data
Right 1043845823 8:85162389-85162411 GATTTGAGATGAGATTTGAGTGG No data
1043845822_1043845823 -3 Left 1043845822 8:85162369-85162391 CCTCGATGTGTGGGGATCACGAT No data
Right 1043845823 8:85162389-85162411 GATTTGAGATGAGATTTGAGTGG No data
1043845821_1043845823 -2 Left 1043845821 8:85162368-85162390 CCCTCGATGTGTGGGGATCACGA No data
Right 1043845823 8:85162389-85162411 GATTTGAGATGAGATTTGAGTGG No data
1043845815_1043845823 8 Left 1043845815 8:85162358-85162380 CCAGGTCCCTCCCTCGATGTGTG No data
Right 1043845823 8:85162389-85162411 GATTTGAGATGAGATTTGAGTGG No data
1043845812_1043845823 15 Left 1043845812 8:85162351-85162373 CCTCCCACCAGGTCCCTCCCTCG 0: 50
1: 660
2: 2404
3: 4276
4: 6528
Right 1043845823 8:85162389-85162411 GATTTGAGATGAGATTTGAGTGG No data
1043845808_1043845823 30 Left 1043845808 8:85162336-85162358 CCCATGATCCAATCACCTCCCAC 0: 1894
1: 4468
2: 9014
3: 11526
4: 10061
Right 1043845823 8:85162389-85162411 GATTTGAGATGAGATTTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043845823 Original CRISPR GATTTGAGATGAGATTTGAG TGG Intergenic
No off target data available for this crispr