ID: 1043848989

View in Genome Browser
Species Human (GRCh38)
Location 8:85194371-85194393
Sequence AGAATCTACTAGAATGTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043848989_1043848990 13 Left 1043848989 8:85194371-85194393 CCATGTACATTCTAGTAGATTCT 0: 1
1: 0
2: 0
3: 20
4: 175
Right 1043848990 8:85194407-85194429 TTCTTGAATATGACAAGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043848989 Original CRISPR AGAATCTACTAGAATGTACA TGG (reversed) Intronic
904917716 1:33982394-33982416 ACAAACTACTAGAAGGTAGAGGG - Intronic
905032695 1:34898312-34898334 GGAATCTAGGAGAATGTAGAGGG + Intronic
905274640 1:36809275-36809297 TGAATTAACTAGTATGTACATGG - Intronic
908459353 1:64334208-64334230 AGATTCTACTAGAATTAAAAAGG - Intergenic
909798690 1:79778011-79778033 AGCAACTACTATAATGTACTTGG - Intergenic
914645675 1:149650113-149650135 AAAATGTACTAACATGTACATGG - Intergenic
917569928 1:176254592-176254614 AGAGACTAATAGAATATACAAGG - Intergenic
919649840 1:200136752-200136774 AGATCCTACTTGAAAGTACAAGG + Intronic
921584467 1:216931139-216931161 AGCATCTAGGAGAAGGTACATGG + Intronic
922000410 1:221472204-221472226 AGAAGCAGCTAGAATGTAGAAGG - Intergenic
923319378 1:232815494-232815516 ATAATCCACTGGAATGTAAAAGG - Intergenic
923734468 1:236590940-236590962 AGAATCTGCTAAAAACTACAGGG + Exonic
924849096 1:247806719-247806741 AGAATACACAAGAATATACAGGG + Intergenic
1067404466 10:46009139-46009161 ATAAACTACTAGAATCCACATGG + Exonic
1067405136 10:46015618-46015640 AGAAAATACAAGAATGTACCAGG + Intronic
1068176397 10:53465178-53465200 AGGATCTACTAGAAAGTAGATGG - Intergenic
1068425736 10:56861141-56861163 AGAATGTACAAGAATGAACAAGG - Intergenic
1069212052 10:65773711-65773733 AGAATCTAATAGAATTTTCAAGG + Intergenic
1070187315 10:74077060-74077082 AGCAGCTACAAGACTGTACACGG - Intronic
1076075807 10:127533001-127533023 TGAATCTTCAAGAATGAACAAGG - Intergenic
1078609016 11:12803267-12803289 AAAATTTCCTCGAATGTACAGGG - Intronic
1085921459 11:80962889-80962911 AGGATCAACTAGAATGGAGAAGG + Intergenic
1087260844 11:96010347-96010369 CAAATCTACTAGAAGATACAGGG + Intronic
1088723575 11:112615307-112615329 AAAATCTAAAAGAATGTTCAAGG - Intergenic
1089071015 11:115699712-115699734 AGAATCTGGTAGCATGTTCATGG + Intergenic
1094113012 12:26881494-26881516 AGAATCTATTACAAGGTAGAGGG - Intergenic
1094556370 12:31504238-31504260 TTAACATACTAGAATGTACATGG + Intronic
1095621337 12:44258234-44258256 TGAATGTAATAGAATGAACAGGG - Intronic
1096013896 12:48248527-48248549 AGAATCTCAGAGAATGTACCAGG + Intergenic
1097384920 12:58939314-58939336 GGAATGTACAAGAATGTTCATGG + Intergenic
1097503275 12:60433309-60433331 AGAATCTTCTAGATTGTGTATGG - Intergenic
1098343636 12:69476890-69476912 AAATTCTATTAGAATGTCCAAGG + Intronic
1101752683 12:107595597-107595619 AGAATCTAAGAGAATGTGGAAGG + Intronic
1105257611 13:18754656-18754678 AGCATTTACTAAAATGTACGAGG + Intergenic
1105260266 13:18773965-18773987 AGCAATTACTAAAATGTACAAGG + Intergenic
1107576389 13:41727507-41727529 AGCATATACTAAATTGTACAGGG + Intronic
1108470704 13:50764051-50764073 AGAGTGTACTAGAACGCACATGG + Intronic
1108572225 13:51763147-51763169 AGAATCTAAAAGAATGTTCAAGG + Exonic
1108931304 13:55825633-55825655 AAAATATACTAGAAGGAACAAGG + Intergenic
1108986216 13:56591309-56591331 AGAATTTACTAGAATGGCCCTGG + Intergenic
1110061019 13:71038211-71038233 AGGACCTACTTGAAGGTACAGGG + Intergenic
1110245360 13:73317386-73317408 AGATCCTACTAGAATGTGCTTGG + Intergenic
1112349082 13:98617980-98618002 AGAAGCGACTAGAATTAACACGG - Intergenic
1113642536 13:111968370-111968392 AGGATTACCTAGAATGTACACGG + Intergenic
1115439486 14:33415806-33415828 AGTATCTAATAGGATGTAAAGGG - Intronic
1116166904 14:41345452-41345474 AGAAACTAAAAGAATTTACAAGG + Intergenic
1117147406 14:52848908-52848930 AGAATCTATGAGAAAGTAAAAGG + Intergenic
1117203934 14:53421098-53421120 AGAATCTACTGGAATTTATTAGG - Intergenic
1117833253 14:59775749-59775771 AGAATGTATTAAAATGTACATGG - Intronic
1120010294 14:79405969-79405991 AGCATTTACTAGAATGTAGAAGG - Intronic
1120023328 14:79554270-79554292 AGAAGGTACTAGAATTCACAAGG + Intronic
1202835376 14_GL000009v2_random:74273-74295 AGCATTTACTGAAATGTACAAGG - Intergenic
1126035187 15:44538763-44538785 AAAATCTGCTACAATGTAGAGGG - Intronic
1126396559 15:48224370-48224392 AGAATTTATTAACATGTACATGG + Intronic
1134779724 16:16884856-16884878 AGAACTTTCTAGAATGTATAAGG + Intergenic
1138088646 16:54156129-54156151 AGCATCCACTACAATGTACAAGG + Intergenic
1138723361 16:59108441-59108463 ACAACCTAATAGAATGAACAAGG - Intergenic
1141419452 16:83903309-83903331 AGAATTTACTAGAACCAACAAGG - Intronic
1146494719 17:33311362-33311384 AGGAGCAACCAGAATGTACATGG - Intronic
1148289858 17:46435569-46435591 AGAATCTAAGAGGATCTACATGG - Intergenic
1148312026 17:46653141-46653163 AGAATCTAAGAGGATCTACATGG - Intronic
1148403857 17:47393411-47393433 AGCATATTCAAGAATGTACATGG + Intronic
1149124490 17:53211197-53211219 ACAAGCTCCTAGAATGAACAAGG - Intergenic
1150826025 17:68476154-68476176 ATAATCTACTATAATCTACTAGG + Intergenic
1151682374 17:75628891-75628913 AGAATCTTCTGGAACCTACACGG - Intronic
1153968034 18:10199570-10199592 AGAATGTCCTGGGATGTACATGG - Intergenic
1154425755 18:14270830-14270852 AGCATTTACTAAAATGTACAAGG - Intergenic
1155019490 18:21882206-21882228 AAAATCAAATAGAATGTAAATGG - Intergenic
1156206649 18:34893456-34893478 AGAATCAACTATCATGTACAAGG - Intergenic
1156596052 18:38549235-38549257 CTAATCTAATAGATTGTACATGG - Intergenic
1157364401 18:47050356-47050378 GGAACTTACTAGAATGTAGATGG + Intronic
1158587406 18:58753377-58753399 AGTATCTACTAAAATAAACAGGG + Intergenic
1161841669 19:6685257-6685279 AGAACCTACTAGAGAGTGCAGGG + Intronic
1162258821 19:9516037-9516059 AGCATCTTCAAGAATGTACCAGG + Intergenic
1163671242 19:18630003-18630025 AGAATGTTCTAGAATGTTCCAGG - Intergenic
1163922031 19:20298973-20298995 ACAATATGCTAGAATGTTCATGG + Intergenic
1164357385 19:27455041-27455063 AGAATCTACCAAAGTATACATGG + Intergenic
1167516534 19:49926565-49926587 AAGATCTTCTAGATTGTACATGG - Intronic
1168161956 19:54516337-54516359 AGAATCCACTGAAATGTAAAGGG + Intergenic
926693375 2:15753135-15753157 AAAATTTAGTAGAAGGTACAGGG - Intergenic
927977439 2:27349529-27349551 AAGATCAACTAAAATGTACAGGG + Intronic
929297035 2:40259844-40259866 AGAAACTAATAGAAGATACATGG - Intronic
929719093 2:44348491-44348513 AGAATGTGCTAGAAGCTACAGGG - Intronic
930133334 2:47875459-47875481 AGAATCTCCTAGAAGGAAGATGG - Intronic
932748623 2:74356455-74356477 GGAATGTACAAGGATGTACAAGG - Intronic
932968417 2:76506777-76506799 AGAAGCTAATATAATGTTCAGGG - Intergenic
934510747 2:94939947-94939969 AGAATCTAGTATAATTAACAAGG - Intergenic
935009537 2:99120091-99120113 AGAATCTAGTAGAAGGGACAGGG - Intronic
937551907 2:123104555-123104577 ACAATCTTCTAAAGTGTACAAGG + Intergenic
938664777 2:133523522-133523544 GGAATCTACTCAAATTTACATGG - Intronic
939101782 2:137903429-137903451 ACAATCTACTACAATATTCATGG - Intergenic
941168440 2:162108645-162108667 AGCATTTACTAGAATGTCCATGG - Intergenic
941483077 2:166042347-166042369 AGGATCTTCTAGAAAGTCCATGG + Exonic
942181416 2:173384448-173384470 AGAATCCACGAGAATGAAAAAGG + Intergenic
942301466 2:174566932-174566954 GGAATTTACTAGAATGTAGATGG + Intronic
942342386 2:174961792-174961814 TGAATCTTCTAGAAGCTACATGG - Intronic
943853709 2:192761701-192761723 AGAAGCAACTAGAATGGACAGGG - Intergenic
945217627 2:207451461-207451483 GGATTCTACAAGGATGTACATGG - Intergenic
946101352 2:217327300-217327322 AGAATCTTCTAGAGATTACATGG + Intronic
1170530481 20:17286566-17286588 ACAATCTACTAAGATGTACCTGG + Intronic
1171883412 20:30634100-30634122 AGCATTTACTGAAATGTACAAGG + Intergenic
1172350971 20:34240421-34240443 TGGATCAACTAGAATTTACAAGG - Intronic
1173337310 20:42123350-42123372 AGCACCTACTACTATGTACAAGG + Intronic
1176843597 21:13859680-13859702 AGCATTTACTAAAATGTACAAGG + Intergenic
1180025481 21:45158767-45158789 ACAGTATGCTAGAATGTACAGGG + Intronic
1184128049 22:42501347-42501369 AGAACCTTCTAGAATGTGCTGGG - Intergenic
1184136840 22:42554660-42554682 AGAACCTTCTAGAATGTGCTGGG - Intronic
949737330 3:7188612-7188634 AGGATCTACTTGAGTGTATAAGG + Intronic
950225725 3:11232629-11232651 AGACTCTTCTAAAATGTATAGGG - Intronic
952638819 3:35566721-35566743 AGAACTGACTAGAATGTACCAGG + Intergenic
956743088 3:72290119-72290141 AGAATATTCCAGAATGTACCAGG - Intergenic
959702172 3:109308838-109308860 AAAACATACTACAATGTACAGGG + Intronic
960796103 3:121490203-121490225 AGCATGTACTAGAATGTAACAGG + Exonic
963485092 3:145925358-145925380 AGAAACTATTAAAATGTAAAGGG - Intergenic
964828813 3:160860305-160860327 GGAATATATTAGAATCTACAAGG - Intronic
970343177 4:15128050-15128072 AAATTACACTAGAATGTACAGGG + Intergenic
971994912 4:33953776-33953798 AGAATCTACAGGAATCTATAAGG - Intergenic
972049507 4:34711495-34711517 TGAATTGACTAGAATTTACAGGG + Intergenic
972978532 4:44667103-44667125 CGAATCTACTAGATTCTGCAGGG + Intronic
973367070 4:49216417-49216439 AGCATTTACTGAAATGTACAAGG + Intergenic
973393554 4:49575989-49576011 AGCATTTACTGAAATGTACAAGG - Intergenic
975038686 4:69716405-69716427 AGATTCTTCTAAAATGTATATGG + Intergenic
975570106 4:75807539-75807561 AGAATCTACTCTGAGGTACATGG - Intronic
976292693 4:83437156-83437178 AGCATCTACTAAAATGAAAATGG - Intronic
976462679 4:85330690-85330712 AGAATAAACTAGAATATGCATGG - Intergenic
976530153 4:86142401-86142423 TGAATCCTCTAGAATGTAAATGG - Intronic
979236935 4:118411101-118411123 AGGAACTACTAAAATCTACAAGG - Intergenic
980600667 4:135019992-135020014 AGTATTTAGTAGAATGGACAAGG - Intergenic
980856761 4:138450155-138450177 AGAATCTACTGGAAGGTTCTGGG + Intergenic
982589623 4:157290441-157290463 CGAATCTTGTAGAATGTCCAAGG - Intronic
982887026 4:160794536-160794558 AGGATCTAGGAGCATGTACATGG + Intergenic
985024507 4:185726990-185727012 AGAATCAACTACAGTGTAAAGGG + Intronic
1202764567 4_GL000008v2_random:138933-138955 AGCATTTACTGAAATGTACAAGG + Intergenic
990010227 5:50988864-50988886 AGAATCTACTTGGATGAATAAGG - Intergenic
991017130 5:61944404-61944426 ATAATATACTAGAATTTATAAGG + Intergenic
993207302 5:84898273-84898295 ACAATCTACTAGAATTTGAAAGG + Intergenic
993572430 5:89558111-89558133 AGCATTTACTAGAATGTAGAGGG - Intergenic
994848885 5:105027175-105027197 ACAATCTACTTGAATGTGAAAGG + Intergenic
994868396 5:105310294-105310316 ATAAACTAATAGAAGGTACATGG + Intergenic
996228008 5:121025421-121025443 ACAAAATACTAGAATGTTCATGG + Intergenic
996407737 5:123122988-123123010 AGAATCTATAAGAATCTATAAGG - Intronic
997103364 5:130992883-130992905 AGAATCTCTTATAATGTAAAGGG - Intergenic
998198798 5:140100868-140100890 TGGATCTACCAGGATGTACAAGG - Intergenic
999536594 5:152524085-152524107 AGAAACTAGTAGAGTCTACAAGG - Intergenic
1000684608 5:164232489-164232511 AGAAAATACTAAAATGCACAAGG - Intergenic
1002796631 6:476508-476530 AAAATCTACTAGTATGTTTATGG + Intergenic
1004853394 6:19724412-19724434 AGAATTTCCTACAATGCACAGGG + Intergenic
1008564761 6:52756204-52756226 GGTATCTAGTAGAAGGTACACGG - Intronic
1008569087 6:52797532-52797554 GGTATCTAGTAGAAGGTACACGG - Intronic
1008575871 6:52859557-52859579 AGTATCGAGTAGAAGGTACACGG - Intronic
1011562702 6:88638039-88638061 TGAATCTATTAAAATGCACAAGG - Intronic
1013263088 6:108466331-108466353 GGAATGTACTAGAATGTTCATGG + Intronic
1014397327 6:120941464-120941486 AGAATGTATTAGAATATTCATGG - Intergenic
1014481348 6:121941422-121941444 AGAATCTACCTGAAGGTGCAGGG - Intergenic
1014756844 6:125310626-125310648 AGATTCTACTATAAAGTACAAGG + Intergenic
1014884299 6:126760831-126760853 AGAATATCCTAGATTGTACCTGG + Intergenic
1015016736 6:128422522-128422544 AGAATATATTGGAAAGTACATGG - Intronic
1015144514 6:129970751-129970773 AGCATGTACTAGAATATTCATGG + Intergenic
1015481821 6:133720308-133720330 AGAATCTGTTAAAATGTAAATGG + Intergenic
1017290600 6:152731323-152731345 CTAATCTAATAGATTGTACATGG + Intergenic
1020542417 7:9475309-9475331 AGAATCTACTTCAATATAAAAGG - Intergenic
1021195813 7:17673168-17673190 AGAATCTACTAGCATGAATTGGG + Intergenic
1025039021 7:55623373-55623395 GGAATCCAATAGAATGGACAAGG + Intergenic
1027467878 7:78537714-78537736 AGAATCTACAAGGAACTACAAGG - Intronic
1029163159 7:98567352-98567374 CGAATCTCCCAGAATGTACAGGG - Intergenic
1031511951 7:122661450-122661472 AGAATATACTAGATGTTACAAGG - Intronic
1031771021 7:125843659-125843681 ACAAACTACTAAAATGTATAAGG + Intergenic
1032729136 7:134620447-134620469 AGAATGAACAAGAATGTTCAGGG - Intergenic
1037208732 8:16358594-16358616 AGAATCTATGAACATGTACAGGG - Intronic
1039272431 8:35897652-35897674 AGAATCTACTAGAAGGTGATTGG - Intergenic
1041168629 8:55117268-55117290 AGAATTTACTAGAAGTTACCAGG + Intronic
1041589526 8:59560822-59560844 TGAATCTACTTAAATGTAGAAGG + Intergenic
1042141076 8:65679298-65679320 AGGATCTATTAAAATGTATAAGG + Intronic
1042460218 8:69056984-69057006 AGATTCTTCTAAAATGTATATGG + Intergenic
1043848989 8:85194371-85194393 AGAATCTACTAGAATGTACATGG - Intronic
1045821845 8:106347568-106347590 AAACTCTACTAGGTTGTACAGGG + Intronic
1046263463 8:111801238-111801260 GGAATCTATTAAAATGTATAGGG + Intergenic
1047126169 8:121963390-121963412 AGAATCTACTGGAAATTATAAGG + Intergenic
1048190469 8:132283600-132283622 GGAATCTACTAAGATGTTCATGG - Intronic
1056299111 9:85223388-85223410 AGAAACTACCAGAAAGTAGAAGG + Intergenic
1059028345 9:110661840-110661862 TGAAACTACTAGAATATAAATGG + Intergenic
1059796153 9:117699209-117699231 AGAACATACTGAAATGTACAGGG + Intergenic
1060784502 9:126439436-126439458 AGAATATAGTACAAGGTACATGG - Intronic
1203545316 Un_KI270743v1:123820-123842 AGCATTTACTGAAATGTACAAGG + Intergenic
1186972032 X:14857293-14857315 AAAATCTGCAAGAATATACAGGG + Intronic
1186987709 X:15034665-15034687 AGACTCCACTACAATGTCCATGG - Intergenic
1187714822 X:22092339-22092361 AGTACCTACTCAAATGTACAAGG - Intronic
1188627167 X:32298900-32298922 AGAAGCTAGAAGAAAGTACAGGG + Intronic
1188981634 X:36732112-36732134 AGAATTCACTAGAATGTGCAAGG - Intergenic
1189849007 X:45160656-45160678 AGAATGTGCTAGAAACTACAGGG + Intronic
1191573764 X:62669601-62669623 AGAATCTACTAGTATATATTTGG + Intergenic
1192505889 X:71682954-71682976 AGAATTAACTTGAATGTAAATGG - Intergenic
1194706387 X:97180373-97180395 AGAATCTACAAGAAACTTCAAGG - Intronic
1199640195 X:149852836-149852858 AGATTCTATTAGAATCAACAAGG + Intergenic
1199753870 X:150846608-150846630 AGAATCCACTAGTAAGTAGAAGG + Intronic
1201211162 Y:11681901-11681923 GGAATCTAATAGAATGGACACGG + Intergenic