ID: 1043850135 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:85206448-85206470 |
| Sequence | GTGTGGAAGGGGAAGGGGAC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1043850127_1043850135 | -2 | Left | 1043850127 | 8:85206427-85206449 | CCACTGGTAGGGATCAACTGTGT | 0: 1 1: 0 2: 1 3: 18 4: 199 |
||
| Right | 1043850135 | 8:85206448-85206470 | GTGTGGAAGGGGAAGGGGACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1043850135 | Original CRISPR | GTGTGGAAGGGGAAGGGGAC AGG | Intronic | ||
| No off target data available for this crispr | |||||