ID: 1043850135

View in Genome Browser
Species Human (GRCh38)
Location 8:85206448-85206470
Sequence GTGTGGAAGGGGAAGGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043850127_1043850135 -2 Left 1043850127 8:85206427-85206449 CCACTGGTAGGGATCAACTGTGT 0: 1
1: 0
2: 1
3: 18
4: 199
Right 1043850135 8:85206448-85206470 GTGTGGAAGGGGAAGGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043850135 Original CRISPR GTGTGGAAGGGGAAGGGGAC AGG Intronic
No off target data available for this crispr