ID: 1043854117

View in Genome Browser
Species Human (GRCh38)
Location 8:85245431-85245453
Sequence CACCAGAGCCTGGAACTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 945
Summary {0: 1, 1: 1, 2: 4, 3: 69, 4: 870}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043854117_1043854120 6 Left 1043854117 8:85245431-85245453 CCTGGCAGTTCCAGGCTCTGGTG 0: 1
1: 1
2: 4
3: 69
4: 870
Right 1043854120 8:85245460-85245482 TCACTTCCTGGAAGTCCTCTAGG 0: 1
1: 0
2: 0
3: 23
4: 249
1043854117_1043854119 -6 Left 1043854117 8:85245431-85245453 CCTGGCAGTTCCAGGCTCTGGTG 0: 1
1: 1
2: 4
3: 69
4: 870
Right 1043854119 8:85245448-85245470 CTGGTGACTCATTCACTTCCTGG 0: 1
1: 0
2: 0
3: 13
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043854117 Original CRISPR CACCAGAGCCTGGAACTGCC AGG (reversed) Intronic
900578827 1:3397637-3397659 CACCAGCGCCGGAAACGGCCAGG - Intronic
900960236 1:5914468-5914490 CACCGCAGCCTGGCAGTGCCGGG - Intronic
901423401 1:9165751-9165773 CACCAGAGCCTCAACCTCCCCGG + Intergenic
902276334 1:15342733-15342755 CACCACAGCCTCGAACTCCCAGG + Intronic
902391824 1:16111381-16111403 CACTGCAGCCTGGAACTCCCAGG + Intergenic
902457847 1:16548592-16548614 CACCAGGGGCTGGAACTGTGGGG + Intergenic
902475294 1:16680933-16680955 CACCAGGGGCTGGAACTGTGGGG + Intergenic
902494312 1:16859321-16859343 CACCAGGGGCTGGAACTGTGGGG - Intronic
902568843 1:17333525-17333547 AACCAGACCCTGGAAAGGCCGGG - Intronic
902719593 1:18295273-18295295 CCCCAGAGCCCAGAACTCCCAGG + Intronic
902849251 1:19140847-19140869 CTGCAGAGCCTGGGACTGTCCGG - Exonic
903045470 1:20561302-20561324 CACTGAAGCCTGGAACTCCCAGG - Intergenic
903046361 1:20566918-20566940 CACCATAGCCTTGACCTCCCAGG - Intergenic
903046770 1:20570202-20570224 CAGCAGTGCCTAGAACTGCTAGG + Intergenic
903099664 1:21018012-21018034 CACCACAGCCTTGATCTCCCAGG + Intronic
903609039 1:24596608-24596630 CACCACAGCCTCGACCTCCCAGG - Intronic
904066596 1:27756981-27757003 CACCACAGCCTTGACCTCCCAGG - Intronic
904180373 1:28662583-28662605 CACTATAGCCTGGAACTCCTGGG - Intergenic
904502512 1:30923793-30923815 CACCACAGCCTTGACCTCCCAGG + Intergenic
904505012 1:30945156-30945178 CACTACAGCCTTGAACTGCCAGG - Intronic
904522434 1:31105924-31105946 CACCATAGCCTGGACCTCCTGGG - Intergenic
904613498 1:31737739-31737761 CCCCAGACCCTGGAGCTGGCGGG - Exonic
904714277 1:32455270-32455292 CACCACAGCCTCCACCTGCCTGG - Intergenic
904776660 1:32912915-32912937 ACTCAGAGCCTGGAACTGTCAGG + Intergenic
905080552 1:35315848-35315870 CACCACAGCCTTGAACTCCTGGG - Intronic
905082275 1:35334241-35334263 CACTATAGCCTCGAACTCCCGGG - Intronic
905511316 1:38522623-38522645 CAGCCCAGCCTGGAACTCCCGGG + Intergenic
905578941 1:39068656-39068678 CACCACAGCCTCGACCTCCCAGG - Intergenic
905590191 1:39156541-39156563 CACCATAGCCTTGACCTCCCAGG - Intronic
906006649 1:42478681-42478703 CACCACAGCCTCGACCTCCCAGG - Intronic
906056798 1:42924312-42924334 GGCCAGCGCCTGGAACCGCCAGG + Intergenic
906164871 1:43678661-43678683 CACCACAGCCTCGACCTCCCAGG + Intronic
906518649 1:46454302-46454324 CACCGCAGCCTGGAACTCCTGGG - Intergenic
908238515 1:62169880-62169902 CACCACAGCCTTGACCTCCCAGG + Intergenic
908553707 1:65235411-65235433 CACTGCAGCCTGGAACTACCGGG - Intergenic
908623009 1:66007054-66007076 CACTAAAGCCTGGAATTGCTGGG - Intronic
909633927 1:77794724-77794746 CACCAGAGCCTTAAACTCCAGGG - Intronic
910626331 1:89311998-89312020 AACCACATCCTGTAACTGCCTGG + Intergenic
910802825 1:91162565-91162587 CACCAGCACCTGGAAAAGCCAGG - Intergenic
910970799 1:92853960-92853982 CACCACAGCCTCGATCTCCCAGG + Intronic
911122790 1:94312718-94312740 CACCACACCCTGGTCCTGCCTGG + Intergenic
912151519 1:106864441-106864463 CAATAGAGCCTGGAACTCCTAGG + Intergenic
912324508 1:108745186-108745208 CACTGCAGCCTGGAACTCCCAGG + Intergenic
912399763 1:109380215-109380237 CACTACAGCCTCGAACTCCCAGG - Intronic
912720901 1:112019075-112019097 CACCAGATACAGGATCTGCCAGG + Intergenic
912865728 1:113254695-113254717 CACCACAGCCTTGACCTCCCTGG + Intergenic
913007899 1:114652755-114652777 CACTACAGCCTTGAACTCCCGGG + Intronic
913611646 1:120514764-120514786 CACCAGGGGCTGGAACTGTGGGG + Intergenic
913644339 1:120842679-120842701 ACCAAGAGCCTGGAACTGCACGG + Intergenic
914006168 1:143734337-143734359 ACCAAGAGCCTGGAACTGCATGG + Intergenic
914098702 1:144565915-144565937 ACCAAGAGCCTGGAACTGCACGG + Intergenic
914177302 1:145289410-145289432 ACCAAGAGCCTGGAACTGCACGG - Intergenic
914228778 1:145745368-145745390 CACCACAGCCTCGACCTCCCAGG - Exonic
914254911 1:145953982-145954004 CACCGCAGCCTGGAACTGCTGGG - Intronic
914502502 1:148259530-148259552 CACTACAGCCTGGAACTCCTGGG - Intergenic
914532030 1:148530901-148530923 ACCAAGAGCCTGGAACTGCACGG - Intergenic
914579546 1:149007475-149007497 CACCAGGGGCTGGAACTGTGGGG - Intronic
914636364 1:149556829-149556851 ACCAAGAGCCTGGAACTGCACGG + Intergenic
916509053 1:165455078-165455100 CACCACAGCCTCGCACTCCCAGG + Intergenic
916618779 1:166473070-166473092 CACCAGTGTATGGAAATGCCTGG - Intergenic
916695775 1:167234656-167234678 CATCACAGCCTGGAACTGCTGGG - Intronic
916725315 1:167517739-167517761 CACCCACGCCTGGGACTGCCGGG - Intronic
917134359 1:171774957-171774979 CACCAGAGCCTGGGGCTGGCAGG - Intergenic
917315307 1:173718650-173718672 CACCACAGCCTCGAACTCCTGGG - Intronic
917666233 1:177228518-177228540 TACCAGAGTCTGGAACTGCCAGG + Intronic
917828868 1:178856301-178856323 CACCACAGCCTCGAACTTCTGGG + Intronic
918197049 1:182232463-182232485 CACCACAGCCTAGAACTTCTGGG + Intergenic
919213205 1:194515319-194515341 CACTGCAGCCTGGAACTCCCAGG - Intergenic
919266168 1:195269351-195269373 CACCTGAGCCTGGAAGGTCCAGG - Intergenic
919855804 1:201705272-201705294 CATCTCAGCCTGGAACTGCCAGG - Intronic
919871836 1:201827976-201827998 CACTACAGCCTGGAACTCCTGGG + Intergenic
920189722 1:204185792-204185814 CACCACAGCCTTGACCTCCCAGG + Intergenic
920196604 1:204231641-204231663 CACCACAGCCTTGAACTCCTAGG + Intronic
920289200 1:204905158-204905180 CATCATAGCCTGGAACTCCTGGG + Intronic
921522698 1:216176309-216176331 CACTACAGCCTGGAACTCCTGGG + Intronic
921672474 1:217941597-217941619 CCCCAGAGCCTGCCAGTGCCTGG - Intergenic
922318390 1:224462713-224462735 CACCAGAGCCTCGACCTCCCAGG + Intronic
922320878 1:224485566-224485588 CACCACAGCCTTGAACTCCTGGG + Intronic
922463843 1:225833066-225833088 CACCACAGCCTCGAACTCCTGGG + Intronic
922660187 1:227423307-227423329 CACTACAGCCTTGAACTCCCAGG + Intergenic
922707977 1:227800445-227800467 CACTACAGCCTTGAACTCCCAGG + Intergenic
922893630 1:229082134-229082156 CACTGGAGCCTTGAACTCCCAGG + Intergenic
923006924 1:230057756-230057778 CCCAAGAGCCCGGATCTGCCTGG + Intergenic
923470588 1:234287121-234287143 CCCTGGAGCCTGGAACTCCCAGG - Intronic
923839877 1:237658465-237658487 CACTGCAGCCTGGAACTACCGGG + Intronic
923857643 1:237862332-237862354 CACATGAGCCTGGACCTGCTAGG - Intergenic
924036713 1:239945352-239945374 AACCAGAGCCCGGAATTGCCTGG + Intergenic
924042033 1:239993087-239993109 AACCAGAGCCTGGAATTGCCTGG - Intergenic
924811382 1:247405581-247405603 CACTGTAGCCTGGAACTCCCAGG + Intergenic
1063048604 10:2420214-2420236 CACCAGAGGCTGGAAGAGGCAGG + Intergenic
1064378984 10:14823601-14823623 CACCAGAGCCTTGACCTCCCAGG + Intronic
1064522267 10:16215600-16215622 AACCAGAGCCAGGAACTCTCAGG + Intergenic
1064569472 10:16677326-16677348 CACCAGGGCCTGGATGTGCATGG + Intronic
1064599049 10:16974688-16974710 CAACAGAGGTTTGAACTGCCTGG + Intronic
1064697572 10:17983410-17983432 CACTACAGCCTTGAACTGCTGGG - Intronic
1064948118 10:20815842-20815864 CACCACAGCCTCGATCTCCCAGG + Intronic
1064991002 10:21256761-21256783 CACTACAGCCTGGAACTCCTGGG - Intergenic
1065306122 10:24370656-24370678 CACTGCAGCCTTGAACTGCCAGG + Intronic
1065380864 10:25088503-25088525 CACTGCAGCCTGGAACTCCCGGG - Intergenic
1065627313 10:27644733-27644755 CACTACAGCCTTGAACTGCTGGG + Intergenic
1065740512 10:28792697-28792719 CACAGGGGCCTGGAAGTGCCGGG + Intergenic
1066358015 10:34703311-34703333 CACCATAGCCTTGAACTCCTGGG - Intronic
1067378546 10:45751331-45751353 CACCAGAGCACTGAACTCCCTGG - Intronic
1067692340 10:48509782-48509804 CTTCAGAGCCTGGAAGTCCCTGG - Intronic
1068772499 10:60837556-60837578 CACCACAGCCTTGACCTCCCAGG - Intergenic
1068939065 10:62663065-62663087 CATTAGAGCCTTGAACTCCCAGG - Intronic
1069504554 10:68986363-68986385 CACCGCAGCCTCCAACTGCCAGG + Intergenic
1069866310 10:71505508-71505530 CAGCACAGCCGGGAAGTGCCGGG - Intronic
1069974870 10:72205095-72205117 CACCATAGCCTTGAACTCCTGGG - Intronic
1070068358 10:73060495-73060517 CACTACAGCCTGGAACTCCTGGG - Intronic
1070915244 10:80149925-80149947 CACTACAGCCTGGACCTCCCAGG + Intergenic
1070958809 10:80484398-80484420 CATCACAGCCTGGACCTCCCAGG + Intronic
1071090449 10:81912295-81912317 CACCGTAGCCTGAAACTGCTGGG + Intronic
1071588736 10:86850705-86850727 CACCACAGCCTTGAACTCCTGGG + Intronic
1072159392 10:92752309-92752331 CTCCACAGCCTCGAACTTCCGGG - Intergenic
1072290089 10:93956845-93956867 CACCACAGCCTCCATCTGCCAGG + Intergenic
1072549574 10:96467255-96467277 CACCGCAGCCTGGAAATCCCAGG + Intronic
1072729057 10:97832548-97832570 CACTACACCCTGGAACTCCCAGG - Intergenic
1072759030 10:98040687-98040709 CACCACAGCCTGGACCTCCTGGG - Intergenic
1072807042 10:98430179-98430201 CCACAGAACCTGGCACTGCCTGG - Intronic
1072960655 10:99926358-99926380 CACTATAGCCTCGACCTGCCAGG + Intronic
1073010601 10:100356298-100356320 CACCACAGCCTTGAACTCCTGGG - Intronic
1073070195 10:100788433-100788455 GACCAGAGGCTGCCACTGCCTGG + Intronic
1073145414 10:101277838-101277860 CACCATAGCCTCGACCTCCCTGG + Intergenic
1073602053 10:104855809-104855831 CACCACAGCCTTGAACTCCTAGG + Intronic
1075039343 10:119095469-119095491 CACCACAACCTGGAACTCCTGGG + Intergenic
1075500599 10:122970276-122970298 CACTAGAGCCTCGAACTCCAGGG - Intronic
1076230768 10:128818205-128818227 CACCAGAGCCAGGCACTTCCAGG + Intergenic
1076516205 10:131045799-131045821 CACTAGAGTCTGCACCTGCCAGG - Intergenic
1076818403 10:132925886-132925908 CAGCGGAGCCTCGCACTGCCTGG + Intronic
1076843269 10:133056958-133056980 CCCCGGAGCCTGGCACTGTCTGG - Intergenic
1076882495 10:133246287-133246309 GACCAGAGCCTGGGACCGGCCGG - Intergenic
1076911505 10:133392342-133392364 CACCCCAGCCTGGATCTGCAGGG + Intronic
1077204863 11:1337256-1337278 CACCACCGCCTGGCACTCCCGGG + Intergenic
1078055037 11:8002372-8002394 CACCACAGCCTTGAACTCCTGGG - Intergenic
1078208724 11:9252923-9252945 CACCACAGTCTGGACCTCCCTGG + Intronic
1078626343 11:12962306-12962328 CACTACAGCCTTGAACTCCCGGG - Intergenic
1079043036 11:17076629-17076651 CACCAGAGCCTAGAAGTCCCAGG - Intronic
1079064758 11:17279863-17279885 CACTGCAGCCTGGAACTGCCAGG + Intronic
1079220404 11:18555510-18555532 CACCGAAGCCTGGATCTACCAGG - Intronic
1079439765 11:20499549-20499571 CACCACAGCCTGGACCTCCTGGG - Intronic
1080051714 11:27865028-27865050 CACCAAACCCTGGAGCTGCTAGG + Intergenic
1080372887 11:31672711-31672733 CACCATAGCCTTGACCTCCCGGG - Intronic
1080599188 11:33806144-33806166 CACCACAGCCTCGAACTCCTGGG + Intergenic
1081208323 11:40300875-40300897 CACTACAGCCTGGAACTCCCGGG + Intronic
1081412619 11:42777616-42777638 CACTGCAGCCTGGAACTCCCGGG + Intergenic
1081517233 11:43845067-43845089 CACTAGAGCCTTGACCTCCCAGG + Intronic
1081691838 11:45083583-45083605 AGCCAGAGCCTGGAGCAGCCGGG + Intergenic
1081754361 11:45534127-45534149 CTCCAGATGCTGGAAATGCCTGG - Intergenic
1082015728 11:47485254-47485276 CACTACAGCCTTGACCTGCCGGG + Intronic
1083229908 11:61310226-61310248 TACCAGAGCCCAGAACAGCCTGG + Intronic
1083340676 11:61956579-61956601 CACTGCAGCCTGGAACTGCTGGG - Intronic
1083549455 11:63575492-63575514 CCCCAGTGCCTGGTCCTGCCAGG + Intronic
1083578139 11:63807221-63807243 CACCACAGCCTCGAACTCCTGGG - Intergenic
1084398925 11:68932435-68932457 CTGCAGAGCCAGGACCTGCCCGG - Intronic
1084443627 11:69190677-69190699 CACTGCAGCCTCGAACTGCCAGG - Intergenic
1084677118 11:70642001-70642023 CTCCAGACCCAGGAACTCCCAGG - Intronic
1084779114 11:71397114-71397136 CCGCAGAGCCTGGAACTTGCCGG + Intergenic
1084793590 11:71490146-71490168 CTCCAGAGGCTGGAAATGGCGGG - Intronic
1084996408 11:72983392-72983414 CACTGCAGCCTTGAACTGCCAGG - Intronic
1085166327 11:74403520-74403542 CACTAGAGCCTGGAACTTCTGGG - Intergenic
1085312526 11:75525102-75525124 AAGCAGAGGCTGGAACTGGCTGG - Intronic
1085699292 11:78732086-78732108 CATGAGTGCCTGGAACTGCCTGG - Intronic
1086551266 11:88055159-88055181 CACTAGAGCCTTGAACTCCTGGG - Intergenic
1087160956 11:94947527-94947549 CACTGCAGCCTGGAACTCCCGGG - Intergenic
1087247419 11:95855329-95855351 CACCACAGCCTTGATCTCCCAGG + Intronic
1087695621 11:101372498-101372520 CACCACAGCCTTGAACTCCTAGG - Intergenic
1087898146 11:103610437-103610459 CACCAGATGCTGATACTGCCAGG + Intergenic
1088043475 11:105418155-105418177 TACCTGAGCCTAGAACTTCCAGG - Intergenic
1089138448 11:116267887-116267909 CTCCAGTGCCTGAAACAGCCTGG - Intergenic
1089141027 11:116284256-116284278 CACCACAGCCTCGAACTCCTAGG + Intergenic
1089260407 11:117220316-117220338 CACCACAGCCTCGAACTCCTGGG + Intronic
1089581989 11:119487097-119487119 CACCACAGCCTTGAACAGCATGG + Intergenic
1090014792 11:123076344-123076366 CAACAGTGCCTATAACTGCCTGG - Intronic
1090362180 11:126181296-126181318 CACTACAGCCTTGAACTCCCGGG - Intergenic
1090371755 11:126260105-126260127 CACCACAGCCTTGACCTCCCCGG + Intronic
1090692021 11:129193404-129193426 CACAACAGCCTTGAACTCCCAGG - Intronic
1090692950 11:129203820-129203842 CACCACAGCCTAGAACTCCTGGG - Intronic
1091731370 12:2883298-2883320 CACCACAGCCTTGACCTCCCAGG - Intronic
1092305881 12:7300079-7300101 CACTGGAGCCTGGACCTCCCAGG - Intergenic
1092533250 12:9362732-9362754 CACCACAGCCTGGACTTCCCAGG + Intergenic
1092687817 12:11071206-11071228 GAGCAGAGCCTGGAATTTCCTGG - Intronic
1093058284 12:14577051-14577073 CACCACAGCCTCGACCTCCCAGG + Intergenic
1093483709 12:19630460-19630482 CACTACAGCCTGGATCTCCCAGG - Intronic
1093869395 12:24269752-24269774 CACTACAGCCTTGAACTCCCGGG + Intergenic
1094151784 12:27293025-27293047 CACCACAGCCTTGAACTCCCAGG + Intronic
1094506715 12:31068311-31068333 CACTACAGCCTTGAACTCCCGGG + Intergenic
1095447359 12:42295604-42295626 CACTGCAGCCTGGAACTCCCAGG - Intronic
1095896894 12:47288864-47288886 CACCGCAGCCTGGAACTCCAGGG + Intergenic
1096285882 12:50299676-50299698 CACTGCAGCCTGGACCTGCCCGG - Intergenic
1096420599 12:51454219-51454241 CACCGCAGCCTTGACCTGCCAGG - Intronic
1097010416 12:55949891-55949913 CACCACAGCCTCGAACTCCTAGG + Intronic
1097672243 12:62554568-62554590 CACTACAGCCTTGACCTGCCAGG + Intronic
1098965888 12:76787998-76788020 CACTACAGCCTGGAACTCCTGGG - Intronic
1100279623 12:93106190-93106212 CACCAGAGCCTCGACCTCCCAGG + Intergenic
1100455303 12:94745799-94745821 CAGGAGTGCCAGGAACTGCCTGG - Intergenic
1100560754 12:95747390-95747412 CACCACAGCCTTGAACTACTGGG + Intronic
1101510794 12:105390533-105390555 CACTGCAGCCTGGAACTCCCAGG - Intronic
1101525109 12:105521425-105521447 CACAAGAGCCTTGAGCTGGCAGG + Intergenic
1102373768 12:112404405-112404427 CACCACAGCCTGGACCTCCTAGG + Intergenic
1102496396 12:113322315-113322337 CCCTAGAGCCTAAAACTGCCTGG - Intronic
1102496472 12:113322864-113322886 CACCTGAGCCTGGAAGTTCAAGG + Intronic
1102866056 12:116374786-116374808 CACTGCAGCCTGGAACTCCCAGG - Intergenic
1102979469 12:117229993-117230015 CACCACAGCCTCGAACTCCTGGG + Intronic
1103141203 12:118549903-118549925 CAGCAAAGCCAGGAGCTGCCAGG + Intergenic
1103249911 12:119490638-119490660 CACCACAGCCTCGAACTCCTGGG + Intronic
1103250477 12:119495729-119495751 CACTAGTGCCTGGAAAAGCCAGG - Intronic
1103306503 12:119969113-119969135 CACCACAGCCTTGACCTCCCAGG - Intergenic
1103416206 12:120742948-120742970 CACCACAGCCTTGACCTCCCAGG + Intergenic
1103514530 12:121498886-121498908 CACCACAGCCTCGAACTCCTGGG + Intronic
1103627268 12:122229175-122229197 CACCACAGCCTTGAACTTCTGGG - Intronic
1103664803 12:122554967-122554989 CACTGCAGCCTGGAACTCCCGGG - Intronic
1104118780 12:125777524-125777546 CACCAGAGCCTCAAAATGCATGG + Intergenic
1104167643 12:126249404-126249426 CACTGGAGCCTGGAACTCCTGGG + Intergenic
1104653278 12:130553658-130553680 CACCTGAGCCTGGAAGTTCAAGG + Intronic
1105348263 13:19593355-19593377 CACCAAAGCCTTGAACTCCTGGG - Intergenic
1105406580 13:20137261-20137283 CACTGCAGCCTGGAACTCCCAGG + Intergenic
1105436226 13:20380618-20380640 CACCAGAACCTGGAAGAGGCAGG + Intergenic
1106116707 13:26824049-26824071 CACCACAGCCTTGACCTCCCAGG + Intergenic
1106325052 13:28680975-28680997 CACCAAAGCCTCGAACTCCTGGG + Intergenic
1107711037 13:43150926-43150948 CAGCAGGGCCTGGAAATGCAAGG + Intergenic
1107969307 13:45625954-45625976 CACCACAGCCCTGAACTGCTGGG + Intergenic
1107993928 13:45842417-45842439 CACCACAGCCTGGACCTCCTGGG + Intronic
1108318281 13:49260016-49260038 CACTACAGCCTTGAACTCCCGGG - Intronic
1108595064 13:51942494-51942516 TTCCACAGCCTGGCACTGCCTGG + Exonic
1108623817 13:52208718-52208740 CACTAGAGCCTGGAAGGGCGAGG - Intergenic
1108864553 13:54906816-54906838 CACCATAGCCTTGACCTGCTGGG - Intergenic
1109684092 13:65790813-65790835 CACCATAGCCTGGACCTCCTGGG + Intergenic
1110220930 13:73072393-73072415 CCACAGAGGCTGGCACTGCCAGG + Intronic
1110850668 13:80241287-80241309 TACCAGCGCCTGGAGCTGCCTGG - Intergenic
1110940008 13:81338497-81338519 CACTACAGCCTTGAACTGCTGGG - Intergenic
1111192748 13:84831808-84831830 CACCAGAGCCAGGCACAGACAGG + Intergenic
1112037958 13:95515079-95515101 CACTATAGCCTTGAACTGCTGGG + Intronic
1112336670 13:98522311-98522333 CCCCAGACCCTGAAACTACCGGG - Intronic
1113477156 13:110592106-110592128 CACCACAGCCTTGAACTCCAGGG - Intergenic
1113515809 13:110897200-110897222 CACCACACCCTGGAACTCCTGGG + Intronic
1113717364 13:112521447-112521469 CACCAGCAGCTGGAACTGGCTGG + Intronic
1113842515 13:113368341-113368363 CACTGCAGCCTGGAACTTCCGGG + Intergenic
1113930912 13:113968384-113968406 TGCCGGAGCCTGGACCTGCCCGG - Intergenic
1114409235 14:22485237-22485259 CACCACATCATGAAACTGCCTGG + Intergenic
1114623971 14:24116436-24116458 CACCACAGCCTGCAACTCCTGGG + Intronic
1115397685 14:32927238-32927260 CACCATAGCCTGGAACTCCTGGG - Intergenic
1115416752 14:33144071-33144093 TACCTGAGACTGGAATTGCCGGG + Intronic
1115416785 14:33144615-33144637 CACTAGAGCCTTGAACTCCTGGG + Intronic
1115542721 14:34437874-34437896 CACCACAGCCTCGACCTCCCAGG + Intronic
1115647377 14:35378436-35378458 CACCGCAGCCTGGAACTCCTGGG - Intergenic
1115670826 14:35609850-35609872 CACTGCAGCCTGGAACTCCCAGG - Intronic
1115998784 14:39220596-39220618 CACCACAGCCTTGACCTCCCAGG + Intergenic
1116343179 14:43753075-43753097 CACCACAGCCTTGACCTCCCAGG + Intergenic
1116904728 14:50393552-50393574 CACCATAGCCTTGAACTGCTGGG + Intronic
1117124432 14:52606512-52606534 CACTACAGCCTGGACCTCCCAGG + Intronic
1117160837 14:52987895-52987917 CACCACAGCCTCGAACTCCTGGG + Intergenic
1117299903 14:54414619-54414641 CACTGTAGCCTTGAACTGCCGGG + Intronic
1117454263 14:55881984-55882006 GACAGGTGCCTGGAACTGCCAGG + Intergenic
1117454265 14:55881992-55882014 GACCAGAGCCTGGCAGTTCCAGG - Intergenic
1117732231 14:58734734-58734756 CATCACAGCCTCGAACTCCCAGG - Intergenic
1117978880 14:61322406-61322428 CAGCAGCTCCTGGAACTGCAGGG - Exonic
1118482146 14:66178147-66178169 CACCACTGTCTGCAACTGCCTGG - Intergenic
1118833489 14:69457809-69457831 CACTACAGCCTGGAACTCCTGGG - Intronic
1119315993 14:73695129-73695151 CACCATAGCCTGGACATCCCAGG + Intronic
1119439504 14:74618908-74618930 CACCAGAGACTGGAAATGAAGGG - Intergenic
1119709951 14:76814379-76814401 CACCAGATCCTGGACCAGCTGGG + Intronic
1120955632 14:90079549-90079571 CAGCAGAGCCTGCAACTGCTGGG + Intronic
1121423609 14:93832844-93832866 CGCCAAGGCCAGGAACTGCCAGG + Intergenic
1121538739 14:94709500-94709522 CACCATAGCCTCGACCTCCCAGG + Intergenic
1121869568 14:97394789-97394811 GAGCAGAGCCTGGAACTGTTAGG + Intergenic
1122431517 14:101651174-101651196 CACTATAGCCTGGAACTCCTGGG - Intergenic
1122518099 14:102322638-102322660 CACTACAGCCTCGAACTCCCAGG + Intronic
1122621579 14:103060612-103060634 CACTGCAGCCTTGAACTGCCAGG + Intergenic
1122637669 14:103138062-103138084 CAGCAGGGCCTGGGACAGCCCGG + Intergenic
1122737887 14:103854288-103854310 CACCAGGGCCTGGACCTGGGTGG - Intergenic
1122914112 14:104848919-104848941 CACTGCAGCCTTGAACTGCCTGG + Intergenic
1123046441 14:105519161-105519183 CACCAGGGCCTTGATCTCCCAGG - Intergenic
1123758216 15:23413403-23413425 CACCACAGCCTTGAACTTCTAGG - Intergenic
1124066973 15:26353815-26353837 CACCAGTACCTGGGACTTCCAGG - Intergenic
1124355681 15:28993197-28993219 CACGAGAGCCGGGAAGTCCCTGG - Intronic
1124426606 15:29568626-29568648 CACGGCAGCCTGGAACTGCTGGG - Intronic
1124657570 15:31521558-31521580 CACCACAGCCTGGTGCTCCCGGG - Intronic
1125049628 15:35282245-35282267 CACTACAGCCTGGAACTCCTGGG + Intronic
1125833906 15:42734688-42734710 CACTACAGCCTGGACCTCCCAGG + Intronic
1125867103 15:43062685-43062707 CACTACAGCCTTGAACTCCCAGG + Intronic
1125917391 15:43501275-43501297 CACCACAGCCTTGAACTCCTGGG + Intronic
1125953636 15:43775031-43775053 CACCACAGCCTTGAACTCCTAGG - Intronic
1126167221 15:45663689-45663711 CACCACAGCCTTGAACTCCTGGG - Intronic
1126588490 15:50315205-50315227 CACCACAGCCTCGACCTCCCAGG + Intronic
1127248688 15:57207029-57207051 CACTACAGCCTGAAACTCCCAGG - Intronic
1127371853 15:58348951-58348973 CACCTGAGCCTGGGGCAGCCAGG - Intronic
1128069304 15:64784277-64784299 CACTGTAGCCTGGAACTCCCAGG - Intergenic
1128245048 15:66127397-66127419 CCCCAGAGCCAGGTCCTGCCTGG + Intronic
1128277799 15:66368451-66368473 CACTACAGCCTGTAACTCCCAGG - Intronic
1128598916 15:68978798-68978820 CACCAGACCCTTGAACTCCTTGG + Intronic
1128799434 15:70488220-70488242 GACCAGAACCTTGAACTGCATGG + Intergenic
1129048917 15:72761772-72761794 CACCACAGCCTTGACCTCCCAGG + Intronic
1129285200 15:74518990-74519012 CACCGCAGCCTCGAACTCCCAGG + Intergenic
1129306537 15:74668642-74668664 CACTACAGCCTTGAACTCCCAGG - Intronic
1129354832 15:74983052-74983074 CACTGGAGCCTCGAACTCCCAGG - Intronic
1129501968 15:76048080-76048102 CACCACAGCCTTGAACTCCTGGG - Intronic
1129651522 15:77494203-77494225 CACTAGAGCCTTGAACTCCTGGG + Intergenic
1129716128 15:77852127-77852149 CCCCATTGCCTGGAACTCCCGGG + Intergenic
1130337132 15:82966023-82966045 CACCACAGCCTCGACCTGCTGGG - Intronic
1130568074 15:85015300-85015322 CACCGGAGCCTCGACCTCCCGGG + Intronic
1130719940 15:86376698-86376720 CTCCAGAGCTTGGAACGGCTAGG + Intronic
1130769891 15:86913782-86913804 CACCTGAGCCTGGAAGTGGAAGG + Intronic
1130772625 15:86939955-86939977 CACCACAGCCTTGACCTCCCAGG + Intronic
1130847853 15:87764231-87764253 CACGAGACCCAGGAACAGCCCGG + Intergenic
1131135651 15:89932925-89932947 CACCGTAGCCTTGAACTCCCGGG - Intergenic
1131160499 15:90102081-90102103 CCCCAGCGCCTGGCACGGCCGGG + Intronic
1131213280 15:90516210-90516232 CACCACAGCCTTGAACTCCTGGG - Intergenic
1131231952 15:90665891-90665913 CACCACAGCCTCGAACTTCCGGG + Intergenic
1131491754 15:92869123-92869145 CACCACAGCCTTGAACTGCTGGG + Intergenic
1131740130 15:95380336-95380358 CACTATAGCCTGGAACTCCTGGG - Intergenic
1132458890 16:39558-39580 CACCACAACCTGAAATTGCCGGG - Intergenic
1132486392 16:194177-194199 CACCGGAGCCTTGACCTCCCAGG + Intronic
1132533727 16:467036-467058 TCCCAGAGCCTGGAACAGGCTGG - Intronic
1132581797 16:688151-688173 CACCTGGAGCTGGAACTGCCTGG + Intronic
1132648409 16:1009681-1009703 CCCCAGAGCCTGGGGCTGCCTGG - Intergenic
1132821356 16:1872896-1872918 CACCACAGCCTTGAACTCCTGGG - Intronic
1132934934 16:2475334-2475356 CTCCAGAGCCCGGCACCGCCCGG + Intronic
1132977381 16:2717447-2717469 TAGCAAAGCCTGGAACTTCCTGG + Intronic
1133037868 16:3044773-3044795 CACCGCAGCCTGGAACTCCTAGG - Intergenic
1133072112 16:3253587-3253609 CACTGCAGCCTGGAACTCCCTGG + Intronic
1133165979 16:3947515-3947537 CACCTCAGCCTCGAACTCCCAGG + Intergenic
1133577773 16:7110283-7110305 CACCACAGCCTGAAACTCCTAGG - Intronic
1133741625 16:8656154-8656176 CACCACGGCCTCGAACTGCTTGG + Intergenic
1134178497 16:12028437-12028459 CACCAAAGCCTGGAACTACTAGG + Intronic
1134416779 16:14050437-14050459 CACCACAGCCTTGACCTCCCAGG + Intergenic
1134458123 16:14409485-14409507 CACCACAGCCTTGAACTTCTGGG + Intergenic
1134532121 16:14991374-14991396 CACCAGAGCCTCAACCTCCCAGG + Intronic
1134646587 16:15872631-15872653 CACCGTAACCTTGAACTGCCGGG - Intronic
1134672640 16:16067172-16067194 CACCACAGCCTCGACCTCCCGGG - Intronic
1134673563 16:16073679-16073701 CACTATAGCCTTGAACTCCCGGG - Intronic
1134836866 16:17368658-17368680 CACCACAGCCTTGAACTTCTGGG + Intronic
1135324806 16:21519691-21519713 GACCTTAGCCTAGAACTGCCGGG + Intergenic
1135356412 16:21772723-21772745 CACCACAGCCTCGAACTCCCTGG - Intergenic
1135392425 16:22105015-22105037 GACCACAGCCTGGAATTGGCGGG - Intronic
1135454906 16:22588867-22588889 CACCACAGCCTCGAATTCCCTGG - Intergenic
1135540928 16:23329949-23329971 CACCGCAGCCTCCAACTGCCTGG - Intronic
1135622819 16:23970426-23970448 CACAAAAGCCTGGAGCTCCCAGG - Intronic
1136034290 16:27527130-27527152 CACCACAGCCTTGATCTCCCAGG - Intronic
1136039649 16:27567886-27567908 CACTACAGCCTGGAACTGCTGGG - Intronic
1136132580 16:28233093-28233115 CACCAGGGCCTGGAAATGGAGGG - Intergenic
1136336293 16:29612966-29612988 GACCTTAGCCTAGAACTGCCGGG + Intergenic
1136483577 16:30557389-30557411 CACTGTAGCCTGGAACTCCCGGG - Intronic
1136711946 16:32245684-32245706 AACCAGAGCCTCGATCTCCCAGG + Intergenic
1136755970 16:32683722-32683744 AACCAGAGCCTCGATCTCCCAGG - Intergenic
1136812143 16:33186650-33186672 AACCAGAGCCTCGATCTCCCAGG + Intergenic
1136818619 16:33296730-33296752 AACCAGAGCCTCGATCTCCCAGG + Intronic
1136825183 16:33353263-33353285 AACCAGAGCCTCGATCTCCCAGG + Intergenic
1136830249 16:33452034-33452056 AACCAGAGCCTCGATCTCCCAGG + Intergenic
1137273798 16:46920127-46920149 CACCGCAGCCTGGAACTCCTGGG - Intronic
1137558032 16:49484910-49484932 CACTACAGCCTGGAACTCCTGGG + Intergenic
1137599429 16:49746174-49746196 AAACAGAGCCTGGAACAGCAGGG - Intronic
1137928397 16:52563577-52563599 CACTGTAGCCTGGAACTCCCTGG - Intergenic
1138090000 16:54166091-54166113 CACTACAGCCTGGAACTCCTGGG - Intergenic
1138160042 16:54744960-54744982 GACATGAGCCTGGAACTGCTGGG - Intergenic
1138515227 16:57532343-57532365 AACCAGAGCCTGGATCTGTATGG - Intronic
1138519917 16:57565139-57565161 AACCAAAGCCTGGTACTGCTGGG + Exonic
1138530303 16:57631086-57631108 AGCCAGAGACTGGGACTGCCTGG - Intronic
1139148972 16:64357749-64357771 CACTGCAGCCTGGAACTCCCAGG + Intergenic
1139313486 16:66046532-66046554 CACCACAGGCTTGAACTCCCAGG - Intergenic
1139399765 16:66671950-66671972 CACCACATCCTCGACCTGCCGGG - Intronic
1139594528 16:67950133-67950155 CACCTGGGCCTGGAGCTGCCTGG - Intronic
1139594857 16:67951579-67951601 CACCAGCCCCTGACACTGCCTGG - Intronic
1139863901 16:70049318-70049340 CACCAGAGCCTCAACCTCCCAGG - Intergenic
1139894922 16:70280901-70280923 CACCATAGCCTTGACCTCCCAGG + Intronic
1140204060 16:72919232-72919254 CACTGCAGCCTGGAACTCCCAGG + Intronic
1140390098 16:74579103-74579125 CACTACAGCCTGGAACTCCTGGG - Intronic
1140672956 16:77297050-77297072 CACTGGAGCCTGGAACTCCTGGG + Intronic
1140868463 16:79084999-79085021 CACCACAGCCTTGAACTACTAGG + Intronic
1141170104 16:81685618-81685640 CACTGCAGCCTCGAACTGCCAGG + Intronic
1141259323 16:82438185-82438207 CATCAGAAACTGTAACTGCCTGG - Intergenic
1141344877 16:83235127-83235149 CACCGCAGCCTTGAACTCCCAGG - Intronic
1141345669 16:83243151-83243173 TACCAGGGCCTCGAGCTGCCTGG + Intronic
1141650712 16:85391494-85391516 CACCAGAGACTGGAAGAGGCAGG - Intergenic
1141735646 16:85850680-85850702 CACCAGAGCCAGGGAAGGCCTGG + Intergenic
1142025155 16:87808685-87808707 CCTCAGAGCCTGGAAGTGGCGGG - Intergenic
1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG + Intronic
1142037013 16:87868748-87868770 GACCTTAGCCTAGAACTGCCGGG + Intronic
1142127380 16:88416917-88416939 CCCCAGGGCCTGGGACTGTCAGG + Intergenic
1142381773 16:89736717-89736739 CACTATAGCCTGGAACTCCCAGG - Intronic
1142390076 16:89793654-89793676 CACCACAGCCTCGACCTCCCTGG + Intronic
1202990721 16_KI270728v1_random:9620-9642 AACCAGAGCCTCGATCTCCCAGG + Intergenic
1203058110 16_KI270728v1_random:944075-944097 AACCAGAGCCTCGATCTCCCAGG - Intergenic
1142699750 17:1651676-1651698 CACCAGACCGTGCACCTGCCTGG - Exonic
1142725437 17:1810491-1810513 CACTGAAGCCTGGAACTCCCGGG + Intronic
1142749759 17:1980137-1980159 CACCAAAGCCTTGACCTCCCAGG + Intronic
1142839330 17:2614648-2614670 CACCAAAGCCTTGAACTCCTGGG + Intronic
1142996034 17:3761068-3761090 CTCCAGAGCCCGGCGCTGCCTGG + Exonic
1143117049 17:4587048-4587070 AACCAGACCGGGGAACTGCCAGG + Intronic
1143168880 17:4914584-4914606 CACCACAGCCTTGACCTCCCAGG + Intergenic
1145734377 17:27216763-27216785 CACCTGAGCCTGGGAGTTCCAGG - Intergenic
1145812260 17:27771471-27771493 CCCAGGAGTCTGGAACTGCCAGG - Intronic
1145926599 17:28652093-28652115 CACTAGAGCCTCGAACTCCTTGG - Intronic
1146230603 17:31104978-31105000 CACCATAGCCTCGAACTCCTGGG + Intronic
1146279231 17:31534341-31534363 CACCACAACCTTGAACTCCCAGG + Exonic
1146334175 17:31955068-31955090 CAACAGAGCCTGGAAGTTCGAGG - Intronic
1147020808 17:37531155-37531177 CACTACAGCCTTGAACTCCCAGG - Intronic
1147175249 17:38651871-38651893 CCACACAGCCTGGAACTGCTGGG - Intergenic
1147435605 17:40412118-40412140 CACTACAGCCTGGACCTCCCAGG - Intronic
1147938258 17:44026154-44026176 CACCACAGCCTTGACCTCCCAGG + Intergenic
1148857189 17:50585219-50585241 CACTACAGCCTGGAACTTCTGGG + Intronic
1148918272 17:51003161-51003183 CACCACAGCCTTGAACTCCTGGG - Intronic
1149287874 17:55185970-55185992 CACCAGAGCATGAAGCAGCCTGG + Intergenic
1149794619 17:59507851-59507873 CACTGCAGCCTGGACCTGCCAGG + Intergenic
1149907853 17:60543064-60543086 CACTAGAGCCTCGAACTCCTGGG - Intergenic
1149934434 17:60791129-60791151 CACTAGAGCCTCAAACTGCTGGG + Intronic
1150088267 17:62295062-62295084 CACCACAGCCTTGAACTCCTGGG + Intergenic
1150203973 17:63386926-63386948 CACCACAGCCTCAAACTCCCGGG + Intronic
1150206108 17:63409245-63409267 CACCAAAGCCTGGAACCCCTGGG + Intronic
1151627611 17:75287187-75287209 CACCATAGCCTTGAACTCCTGGG + Exonic
1151743757 17:76000928-76000950 ACCCAGAGCCTGGGACTGGCTGG + Exonic
1152483464 17:80572647-80572669 CACTGCAGCCTGGAACTGCTGGG - Intronic
1152512396 17:80799192-80799214 CACGAGAGCCTGTTTCTGCCTGG - Intronic
1152528242 17:80901955-80901977 CACCAGGGCCAGGCACTGCTGGG - Intronic
1152837486 17:82543325-82543347 CACTGCAGCCTGGAACTCCCGGG + Intronic
1153568947 18:6449051-6449073 CACCACAGCCTTGAACTCCTAGG - Intergenic
1153608636 18:6859364-6859386 GACGACAGCCTGGAGCTGCCAGG - Intronic
1153809453 18:8739167-8739189 CACCACAGCCTGGAACTCCTGGG - Intronic
1155468110 18:26161660-26161682 CACTACAGCCTGGAACTCCTGGG - Intronic
1156839460 18:41594568-41594590 CACTGCAGCCTGGAACTCCCAGG - Intergenic
1157697257 18:49732803-49732825 CACCACAGCCTCGACCTCCCAGG + Intergenic
1158870725 18:61685121-61685143 CACTGCAGCCTGGAACTCCCGGG - Intergenic
1158917136 18:62144888-62144910 CACTACAGCCTGGAACTCCTGGG - Intronic
1159746867 18:72247267-72247289 CACCAGAGCCTGCATCTCCCTGG - Intergenic
1159857583 18:73607601-73607623 CACCGCAGCCTTGAACTCCCAGG + Intergenic
1160281941 18:77499179-77499201 CACCAGAACCAGGAACCACCAGG - Intergenic
1160281972 18:77499353-77499375 CACCAGAGCCAGGAACCACCAGG - Intergenic
1160585411 18:79911095-79911117 GAGCAGAGCCTGGAACAGCGTGG + Intronic
1160812357 19:1018285-1018307 CCCCAGCACCTGGCACTGCCTGG + Intronic
1160820439 19:1055253-1055275 CCCCAGAGCCGGTCACTGCCTGG - Exonic
1160889571 19:1370156-1370178 CACCACAGCCTTGAACTCTCGGG - Intronic
1161263955 19:3354530-3354552 CACTACAGCCTGGAACTCCCGGG + Intergenic
1161291216 19:3494289-3494311 CCCCAGAGCAAGGCACTGCCTGG + Intronic
1161569274 19:5021495-5021517 CACTGCAGCCTGGAACTCCCGGG - Intronic
1161753304 19:6113233-6113255 CACCACAGCCTAGAACTCCTGGG - Intronic
1161850581 19:6736168-6736190 CACTACAGCCTCGAACTCCCAGG + Intronic
1161884475 19:6983211-6983233 CACCAGAGGCTGGAAGAGGCAGG - Intergenic
1161916777 19:7234280-7234302 CACTGCAGCCTGGAACTCCCTGG + Intronic
1161939500 19:7394161-7394183 CACCGCAGCCTGGACCTCCCAGG + Intronic
1162298063 19:9827299-9827321 ACCAAGAGCCTGGAACTGTCCGG + Intronic
1162308113 19:9887955-9887977 CACCACAGCCTCGACCTCCCAGG - Intronic
1162342088 19:10097304-10097326 CACTGCAGCCTGGAACTGCTGGG - Intronic
1162370817 19:10278119-10278141 CACTACAGCCTGGACCTCCCAGG - Intronic
1162699244 19:12501303-12501325 CACCACAGCTTGGACCTCCCAGG - Intronic
1163435675 19:17293767-17293789 CACCACAGCCTTGAACTCCTGGG + Intronic
1163549956 19:17960761-17960783 CACCAGAGGCTGGAAGAGGCAGG - Intronic
1163631815 19:18421410-18421432 CTCCAGAGCCAGCAGCTGCCTGG - Intronic
1164575516 19:29403312-29403334 CACCTGTGCCTGCCACTGCCTGG - Intergenic
1164660303 19:29959206-29959228 CACCTGAGCCTGGGAGTTCCAGG - Intronic
1164852992 19:31500255-31500277 CATCAGAGCCTGGATCCGGCTGG - Intergenic
1164983793 19:32633406-32633428 CACTACAGCCTTGAACTACCAGG + Intronic
1165016835 19:32887291-32887313 CACCACAGCCTTGAACTCCTGGG + Intronic
1165076418 19:33282142-33282164 CACCAAAGCCTGGACTTCCCTGG + Intergenic
1165190979 19:34063218-34063240 CACTGCAGCCTGGAACTCCCAGG - Intergenic
1165197635 19:34117383-34117405 CACTACAGCCTGGAATTCCCGGG + Intergenic
1165212768 19:34248979-34249001 CACAGCAGCCTTGAACTGCCGGG + Intergenic
1165370579 19:35403169-35403191 CACTACAGCCTGGAACTCCTGGG + Intergenic
1165421528 19:35724420-35724442 CACCGCAGCCTTGAACTCCCAGG - Intronic
1165552616 19:36601474-36601496 CACTACAGCCTGGAACTCCTGGG - Intronic
1165889932 19:39105594-39105616 CACTACAGCCTGGACCTCCCAGG + Intronic
1166000790 19:39876281-39876303 CACTGTAGCCTGGAACTGCTGGG - Intronic
1166675339 19:44737574-44737596 CCCCAGAGCCTGGCTCTCCCTGG + Intergenic
1166683002 19:44779391-44779413 CTCCAGACCCAGGACCTGCCTGG + Intronic
1166808943 19:45504109-45504131 CACCACAGCCTCGAACTCCTGGG + Intergenic
1167145412 19:47678638-47678660 CACCGTAGCCTGGAACTCCTGGG + Intronic
1167153957 19:47726750-47726772 CACCACAGCCTTGAACTCCTGGG + Intronic
1167394499 19:49219138-49219160 CACCATAGCCTCGACCTCCCAGG - Intergenic
1167470208 19:49671560-49671582 CACCACAGCCTTGAACTCCTGGG - Intronic
1167715499 19:51140536-51140558 ACCAAGAGCCTGGAACTGCATGG + Intergenic
1167979295 19:53259489-53259511 CTGCAGAGCCTGGATCTGCTGGG - Exonic
1168543003 19:57228552-57228574 CACTACAGCCTCGAACTCCCAGG - Intergenic
1202709535 1_KI270714v1_random:9987-10009 CACCAGGGGCTGGAACTGTGGGG + Intergenic
925073255 2:987905-987927 ACCCAGGGGCTGGAACTGCCGGG - Intronic
925125793 2:1455026-1455048 CTCCAGAAGCTGGAATTGCCAGG - Intronic
925180885 2:1816361-1816383 CTCCTGAGCCAGGAATTGCCAGG - Intronic
925318107 2:2940446-2940468 CCCCAGAGCCTGCCCCTGCCAGG + Intergenic
925318148 2:2940571-2940593 CCCCAGAGCCTGTCCCTGCCAGG + Intergenic
925502783 2:4524647-4524669 CACTACAGCCTGGAACTCCTGGG + Intergenic
926028948 2:9568962-9568984 CACTGTAGCCTGGAACTCCCCGG + Intergenic
927165321 2:20314068-20314090 CACCAAAGCCTTGACCTCCCGGG - Intronic
927591381 2:24360618-24360640 CTCCGGAGCCCGAAACTGCCCGG + Exonic
927638246 2:24831452-24831474 CACCACAGCCTGCCACAGCCTGG + Intronic
927681546 2:25142854-25142876 CACTACAGCCTTGACCTGCCAGG - Intronic
927692463 2:25217726-25217748 CACTAAAGCCTGGAACTCCTAGG - Intergenic
927885933 2:26718682-26718704 CACCACAGCCTCGACCTCCCGGG + Intronic
927902523 2:26831058-26831080 CACGGGAGCCAGGAACTGGCAGG - Intergenic
928170073 2:28997970-28997992 CACCAGAGCCTGGCAGGGCCAGG - Intronic
928329869 2:30349427-30349449 CACCACAGCCAGGTAATGCCAGG - Intergenic
928667280 2:33562341-33562363 CACCACAGCCTCGAACTCCTGGG + Intronic
928961678 2:36932676-36932698 CACTACAGCCTTGAACTCCCGGG + Intronic
929426528 2:41850033-41850055 CAGCAGGGCCTAGACCTGCCGGG + Intergenic
929481857 2:42315805-42315827 CACCACAGCCTTGAACTTCTGGG - Intronic
929787630 2:45003833-45003855 CCCCAGAGGCTGGGACTGCACGG - Intergenic
930501429 2:52223907-52223929 CACTACAGCCTGGAACTCCTGGG - Intergenic
931726789 2:65119119-65119141 CACCAGAGCCTGGGAAGTCCAGG + Intronic
931776502 2:65545608-65545630 CACCGTAGCCTAGAACTCCCGGG + Intergenic
932728440 2:74199348-74199370 CACCAGAGCCTGTCAGTGCCGGG + Intronic
932848179 2:75156294-75156316 CACCAGAAGCTGGAAATGGCAGG + Intronic
933948683 2:87309694-87309716 CACCATAGCCTGGAACTACTGGG + Intergenic
934684665 2:96311962-96311984 CACTATAGCCTGGAACTCCTGGG - Intergenic
935121652 2:100188297-100188319 CACGATAGCCTTGAACTCCCAGG + Intergenic
935228948 2:101079448-101079470 CACCGCAGCCTTGAACTCCCAGG + Intronic
936331515 2:111551902-111551924 CACCATAGCCTGGAACTACTGGG - Intergenic
936773151 2:115939069-115939091 CACTACAGCCTTGAACTCCCGGG - Intergenic
937060485 2:118977232-118977254 AAACACTGCCTGGAACTGCCAGG + Intronic
937095381 2:119232141-119232163 CACCAGAGTCTGGTGCTGACTGG + Intronic
938023201 2:127923063-127923085 CACTGCAGCCTTGAACTGCCGGG + Intergenic
938826086 2:135006732-135006754 CACCATAGCCTTGACCTCCCGGG - Intronic
939517279 2:143184755-143184777 CACCACAGCCTTGAACTCCTGGG + Intronic
939735172 2:145835214-145835236 CACAAGAGCCTCAAACTCCCAGG + Intergenic
941070952 2:160954034-160954056 CCCCTGAGGCTGGAGCTGCCTGG - Intergenic
941796915 2:169609282-169609304 CACCACAGCCTCGACCTCCCTGG + Intronic
942155701 2:173124910-173124932 CACTATAGCCTGGAACTCCTGGG - Intronic
942168749 2:173268478-173268500 CACTACAGCCTTGACCTGCCAGG - Intergenic
942506087 2:176642950-176642972 CACCAAAGCCTGGTACTGCCTGG - Intergenic
944311384 2:198237424-198237446 CACCACAGCCTGGAGCTTCTAGG + Intronic
944742480 2:202625813-202625835 CACCTGAGCCTGGAAGTTCAAGG + Intergenic
945083849 2:206111829-206111851 CACCACAACCTTGAACTCCCAGG + Intergenic
945273700 2:207967057-207967079 CACCGCAGCCTGGAACTCCTGGG + Intronic
945702461 2:213189197-213189219 CACCAGAGCCTTTTTCTGCCGGG - Intergenic
946904565 2:224403810-224403832 CAGCACAGCCTGGAACTCCTGGG - Intergenic
947425767 2:229981624-229981646 CACTACAGCCTGGACCTCCCAGG - Intronic
947452635 2:230222646-230222668 CACCAGAGACTGGACCTCCTGGG - Intronic
947899274 2:233706866-233706888 AACCAGAGCTGGGAAGTGCCAGG - Intronic
947905545 2:233759108-233759130 TACCAGAGGCTGTAACTCCCTGG - Intronic
947945415 2:234097735-234097757 CACCACAGCCTGGAACTCCTGGG + Intergenic
948154348 2:235769284-235769306 CACCAGAGCCAGGACATGCCTGG + Intronic
948582941 2:239000267-239000289 CACCAGACACTGCATCTGCCTGG - Intergenic
948697700 2:239741554-239741576 CACACGCACCTGGAACTGCCTGG + Intergenic
948761755 2:240196760-240196782 CACCAGAACCTGGAAGAGGCAGG + Intergenic
949041605 2:241852280-241852302 CACCAGGGTTTGGAACTGGCCGG + Exonic
1168755725 20:316103-316125 CACTGCAGCCTGGAACTCCCAGG + Intergenic
1168798646 20:629423-629445 CACTGCAGCCTGGAACTCCCGGG + Intergenic
1168895677 20:1321722-1321744 CACCAGAGATTGGAACTGGTGGG + Intronic
1169140031 20:3222565-3222587 CACCAGAGGCTGCAAAAGCCTGG - Intronic
1169385190 20:5142916-5142938 CACCAAAGCCTCAAACTGCTGGG + Intronic
1169735334 20:8831703-8831725 CACCATAGCCTGAAACTCCTGGG + Intronic
1170164853 20:13350765-13350787 CACTACAGCCTTGAACTGCTAGG + Intergenic
1170761619 20:19256021-19256043 CACTGCAGCCTGGAACTGCTGGG - Intronic
1170763506 20:19272176-19272198 CTGCAGAGCCTGCAAGTGCCTGG - Intronic
1171962053 20:31501951-31501973 CACCACAGCCTCAAACTCCCAGG + Intergenic
1171968888 20:31550900-31550922 CACTTCAGCCTGGAACTCCCAGG - Intronic
1172369996 20:34381786-34381808 CACTATAGCCTGGAACTCCTGGG - Intronic
1172520665 20:35563464-35563486 CACTGGAGCCTGGACCTCCCAGG - Intergenic
1172573053 20:35985221-35985243 CACCACAGCCTCGAACTCCTGGG - Intronic
1173255352 20:41390767-41390789 CACTACAGCCTTGAACTCCCGGG + Intergenic
1173561338 20:44007762-44007784 CACCACAGCCTTGACCTCCCGGG - Intronic
1173952725 20:47006112-47006134 CACTGCAGCCTGAAACTGCCAGG - Intronic
1173967036 20:47120298-47120320 CACCACAGCCTTGAACTCCTGGG - Intronic
1173984094 20:47247735-47247757 TACCAGAGCCATGAACAGCCCGG + Intronic
1175261748 20:57678995-57679017 CAGAAGAGCCAGGAACTGCAGGG + Intronic
1175424630 20:58855642-58855664 CAGGTGAGCCAGGAACTGCCGGG + Intronic
1175662770 20:60830753-60830775 CACCACAGCCTTGAACTCCTGGG + Intergenic
1175756951 20:61536059-61536081 CACCAGAGCCTGGAAGACCATGG + Intronic
1175881307 20:62260912-62260934 CACCATAGCCTCGAACTTCTGGG - Intronic
1175952473 20:62590803-62590825 CACAAGGGCCTGGGAGTGCCAGG - Intergenic
1175954074 20:62599416-62599438 GCACAGGGCCTGGAACTGCCAGG - Intergenic
1176235420 20:64051426-64051448 CACCAGGGCCTGGCTCAGCCTGG + Intronic
1176289752 21:5037751-5037773 CCCCAGGGCCTGGGCCTGCCTGG - Intronic
1176845905 21:13876195-13876217 CCCCAGGGCCTGTAACAGCCAGG + Intergenic
1177784178 21:25652314-25652336 CACCACAGCCTCGATCTCCCAGG - Intronic
1178150689 21:29790537-29790559 CACCTGAGCCTGGAAGTTCGAGG - Intronic
1178309955 21:31521659-31521681 CACTACAGCCTTGAACTCCCGGG - Intronic
1178533101 21:33391579-33391601 CACCGCAGCCTGGAACTCCTGGG - Intergenic
1178949663 21:36975695-36975717 CACTACATCCTGGAACTCCCGGG - Intronic
1179165475 21:38932192-38932214 CACCACAGCCTGGACCTGCCAGG + Intergenic
1179219633 21:39394943-39394965 CACTACAGCCTGGAACTCCTTGG + Intronic
1179781052 21:43701265-43701287 TCCCAGCGCCTGGCACTGCCTGG - Intergenic
1179867478 21:44225836-44225858 CCCCAGGGCCTGGGCCTGCCTGG + Intronic
1179882827 21:44300526-44300548 CCCCAGAGCCTGGCCCTTCCTGG + Intronic
1179907006 21:44427658-44427680 CACCAGAACCTGGGACTGGGGGG + Intronic
1180122083 21:45760250-45760272 CACCACAGCCTCGAACTCCTGGG + Intronic
1180140829 21:45892638-45892660 CAGCTGAGGCTGGCACTGCCAGG + Intronic
1180626504 22:17197343-17197365 CACCTGAGCCTGGAAATTCAAGG - Intronic
1180667673 22:17527380-17527402 CACTGGAGCCTGGACCTCCCAGG - Intronic
1181115612 22:20631234-20631256 CAACAGAGGGTGGAACTGGCTGG - Intergenic
1181181222 22:21069896-21069918 CACCAAGGCCTGGGCCTGCCTGG + Intergenic
1181281794 22:21725921-21725943 CACCATAGCCTCGACCTCCCCGG - Intronic
1181500984 22:23315425-23315447 CAGCAGCACCTGGACCTGCCCGG - Exonic
1182146049 22:27997429-27997451 CACCAGCACCTGGGGCTGCCAGG + Intronic
1182395281 22:30031205-30031227 CACCACAGCCTGAAACTCCTAGG - Intergenic
1182449813 22:30412745-30412767 CACCACAGCCTCGAACTCCTGGG - Intronic
1182464635 22:30506722-30506744 CACCAGAGCTGGGAGCTGCAGGG + Intergenic
1183372772 22:37444034-37444056 CACCAAAGCCTTGAACTCCTGGG - Intergenic
1183442886 22:37833243-37833265 CACCAGAGCCTGGCTCTGCGTGG + Intronic
1183626144 22:39003436-39003458 CACCTGGGCCTGCAGCTGCCAGG + Intergenic
1183774937 22:39957858-39957880 CACCACAGCCTTGAACTCCCAGG - Intronic
1183962530 22:41420321-41420343 CACTGCAGCCTGGAACTCCCAGG - Intergenic
1184176937 22:42794005-42794027 CACCCCAGCCTGGGACAGCCGGG - Intergenic
1184438302 22:44493811-44493833 CCCTACAGGCTGGAACTGCCAGG + Exonic
1184615067 22:45632386-45632408 CACCACAGCCTCGACCTCCCAGG - Intergenic
1184621707 22:45684025-45684047 CACCATAGCCTTGAACTCCTGGG + Intronic
1184756183 22:46517169-46517191 CTGCAGAGCATGGAGCTGCCAGG + Intronic
1184853276 22:47132895-47132917 AACCAGGGCCTTGAACTCCCTGG + Intronic
1184931249 22:47682733-47682755 CACCAGATGCTGAACCTGCCTGG - Intergenic
1184998810 22:48229180-48229202 CACCAGAGGCTGGAAGAGGCAGG + Intergenic
1185139413 22:49092086-49092108 CACCAGAGGCTGGAAGAGGCAGG + Intergenic
1185303609 22:50099308-50099330 CACCAGACCCGGAATCTGCCAGG + Intronic
1185347049 22:50315001-50315023 CACCAGTGCCTGGGCCAGCCTGG - Intronic
1185353942 22:50354941-50354963 CACCACAGCCTTGACCTGCCAGG + Intronic
949211652 3:1510325-1510347 CACCACAGCCTCGAACTCCTGGG + Intergenic
949271157 3:2218442-2218464 CACCACATCCTTGAACTCCCAGG - Intronic
949349925 3:3114947-3114969 CACCAGAGCCTCAAACTCCTGGG - Intronic
949484181 3:4521784-4521806 CACCTGAGCCTGGGAGTTCCAGG + Intronic
949484183 3:4521792-4521814 CACAGTAGCCTGGAACTCCCAGG - Intronic
949536353 3:4999036-4999058 CCCGAGTGGCTGGAACTGCCTGG + Intergenic
949864890 3:8539456-8539478 CAGCAGAGCCAGGACATGCCCGG + Intronic
950349408 3:12332953-12332975 CACTGGAGCCTGGACCTCCCGGG - Intronic
950431427 3:12953256-12953278 CATCAGAGCCTGGAACTGCCGGG + Intronic
950780142 3:15384661-15384683 CACCTCAGCCTGGAACTCCTGGG - Intronic
950829729 3:15860799-15860821 AACCAGAGGCTGGAGCCGCCCGG - Intergenic
951536075 3:23742030-23742052 CACCGCAGCCTTGAACTCCCAGG - Intergenic
953328516 3:42032844-42032866 CACCACAGCCTTGAACTCTCGGG - Intronic
953648774 3:44780161-44780183 CACCACAGCCTGGAACTCCTGGG + Intronic
954073827 3:48162359-48162381 CACCACAGCCTCGACCTGCTGGG + Intronic
954283395 3:49600726-49600748 CACTAGAGCCTCGACCTCCCTGG - Intronic
954545898 3:51434324-51434346 CACTACAGCCTTGAACTCCCCGG - Intronic
954715901 3:52526733-52526755 CACCACAGCCTCGAACTCCTGGG + Intronic
954786149 3:53093936-53093958 CACCATAGCCTTGAACTCCTGGG - Intronic
955393784 3:58540334-58540356 ACCAAGAGCCTGGAACTGCATGG + Intergenic
955737261 3:62052609-62052631 CACCTGAGCCTGGGAGTTCCAGG + Intronic
955737263 3:62052617-62052639 CACTGCAGCCTGGAACTCCCAGG - Intronic
955871239 3:63440900-63440922 CACCAGAGATTGGAACTTGCTGG - Intronic
956165075 3:66392306-66392328 CACCCAAGAGTGGAACTGCCAGG + Intronic
956615481 3:71167186-71167208 CAGCAGAGCCTGGAGAAGCCCGG + Intronic
956671932 3:71699149-71699171 CACCACAGCCTTGACCTCCCAGG - Intronic
958179075 3:90034286-90034308 TACCAGACCCTTGAGCTGCCAGG - Intergenic
958427273 3:93993494-93993516 CACTACAGCCTTGACCTGCCAGG + Intronic
958734502 3:97993086-97993108 CACCAGATCCTGGAAATGAATGG - Intronic
958923494 3:100132325-100132347 CACTATAGCCTTGAACTGCTGGG - Intronic
960932261 3:122864935-122864957 CACTACAGCCTCGAACTTCCAGG - Intronic
961388840 3:126540140-126540162 CACCAGAGCCAGGGCCTGCTTGG - Intronic
961795635 3:129406934-129406956 CACCACAGCCTTGAACTCCTGGG + Intronic
962804443 3:138916595-138916617 CACTGCAGCCTGGACCTGCCAGG - Intergenic
963339599 3:144019034-144019056 CACCACAGCCTTGAACTCCTGGG + Intronic
963341873 3:144046316-144046338 CACCACAGCCTTGACCTCCCGGG + Intronic
963503255 3:146155246-146155268 CACTACAGCCTGAAACTGCTGGG - Intronic
963555212 3:146778620-146778642 CATCAGTCCCTGGAACTGACAGG - Intergenic
963618117 3:147569566-147569588 CACTGCAGCCTGGAACTGCTGGG - Intergenic
963727702 3:148940379-148940401 CACTACAGCCTTGAACTCCCTGG - Intergenic
963905238 3:150768198-150768220 CATTACAGCCTGGAACTCCCAGG + Intergenic
964328638 3:155575730-155575752 CACTGCAGCCTGGAACTCCCAGG + Intronic
965010923 3:163089962-163089984 CACTACAGCCTGGTACAGCCTGG - Intergenic
965459446 3:168943799-168943821 CACCATAGCCTTGACCTCCCAGG + Intergenic
965761694 3:172084373-172084395 CACCACAGCCTTGACCTCCCAGG - Intronic
966696131 3:182792892-182792914 CCCCTGAGCCTGGTACAGCCTGG - Intergenic
966747888 3:183295722-183295744 CTCCAGTGCCTGGAACACCCTGG + Intronic
968020259 3:195379726-195379748 CACTACAGCCTGGAACTCCCAGG - Intronic
968501828 4:953759-953781 CACCACAGCCTCGACCTCCCGGG + Intronic
968725359 4:2245424-2245446 CAGCAGAGCCTGGGACTGGTGGG + Intergenic
968737495 4:2304893-2304915 CACCAGCTCCTGCAGCTGCCTGG - Exonic
968746490 4:2363098-2363120 CACCAAGCCCTAGAACTGCCAGG - Intronic
969359246 4:6651446-6651468 CACTCCAGCCTGGAACTCCCAGG - Intergenic
969706299 4:8794075-8794097 CAGCAGGAGCTGGAACTGCCAGG - Intergenic
969718023 4:8877765-8877787 CCCTGGAGCCTGGAACCGCCGGG + Intergenic
970463848 4:16303908-16303930 AAGCAGAGCCTGGACTTGCCTGG - Intergenic
971236276 4:24845040-24845062 CTTCAGAGCCCTGAACTGCCGGG - Intronic
971414757 4:26414243-26414265 CACCACAGCCTTGACCTCCCAGG + Intronic
971915980 4:32870460-32870482 CACCACAGCCTTGACCTTCCTGG + Intergenic
972214209 4:36876727-36876749 CACCACAGCCTTGATCTCCCAGG + Intergenic
972281001 4:37602139-37602161 CACCAGAGCCTCGACCTCCCAGG - Intronic
972315461 4:37921791-37921813 CACTACAGCCTTGAACTTCCAGG + Intronic
972315463 4:37921799-37921821 CACCTGAGCCTGGAAGTTCAAGG - Intronic
972486403 4:39545280-39545302 CACAATAGCCTGGAACTACTGGG + Intergenic
972599595 4:40560516-40560538 GACCAAAGGCTGGCACTGCCGGG - Intronic
972722817 4:41717841-41717863 CACCACAGCCTTGAACTTCTGGG + Intergenic
972956673 4:44400910-44400932 CACCACAGCCTTGAACTCCTGGG + Intronic
973735497 4:53867199-53867221 CACCTGAGCCTGGAACTCCTGGG - Intronic
973948539 4:55986464-55986486 CACTACAGCCTTGAACTCCCAGG - Intronic
973981840 4:56314376-56314398 CAGCGGAGCCTGGAAGCGCCAGG + Exonic
974134927 4:57803611-57803633 CACTACAGCCTGGAACTCCTGGG + Intergenic
975671443 4:76785010-76785032 CACCACAGCCTCGAACTCCCAGG + Intergenic
976602893 4:86954651-86954673 CACCACAGCCTTGACCTTCCAGG - Intronic
976718590 4:88149138-88149160 CACTGCAGCCTGGAACTCCCTGG - Intronic
978466150 4:109012086-109012108 CACCACAGTCTTGAACTCCCAGG + Intronic
978796875 4:112716639-112716661 CACCACAGCCTTGAACTCCTGGG + Intergenic
978817913 4:112930371-112930393 CACCATAGCCTTGACCTCCCTGG - Intronic
979519556 4:121650685-121650707 CACCACAGCCTTGACCTCCCAGG - Intergenic
980282268 4:130737019-130737041 GGCCTGAGCCTGGAACTGGCAGG + Intergenic
980330541 4:131404616-131404638 CACCACAGCCTCGAACTACCAGG + Intergenic
980518434 4:133896872-133896894 CATCACAGCCTGGAACTCCCGGG - Intergenic
980904535 4:138934424-138934446 CACTGGAGCCTGGACCTCCCGGG - Intergenic
982212493 4:153050234-153050256 CACCATAGCCTCAAACTGCTGGG - Intergenic
982378920 4:154726683-154726705 CACCACAGCCTTGAACTCCTGGG - Intronic
983299595 4:165908497-165908519 CACCTGAGCCTGGAAGTGAAAGG + Intronic
983841933 4:172467967-172467989 CACTACAGCCTGGAACTCCTGGG + Intronic
984372335 4:178883685-178883707 CACTACAGCCTTGAACTCCCTGG + Intergenic
985000573 4:185478419-185478441 GGCCAGAGCCTGGGACTGGCTGG - Intergenic
985613667 5:906134-906156 CACCACAGCCTGGACCTCCTGGG - Intronic
985993568 5:3583768-3583790 CTCCAGCCTCTGGAACTGCCAGG + Intergenic
986140066 5:5021247-5021269 CACCACAGCCTTGACCTCCCCGG + Intergenic
986649999 5:9953906-9953928 CAACAGTGACTGGAGCTGCCTGG - Intergenic
987188736 5:15451455-15451477 CTCCAGACACTGGAACTGCTCGG - Intergenic
987321612 5:16775502-16775524 CACTACAGCCTCGAACTCCCTGG + Intronic
987327869 5:16828789-16828811 AACTACAGCCTGGAACTCCCGGG + Intronic
987443485 5:17986589-17986611 CACTAAAGCCTGGAACTTCTGGG - Intergenic
987835340 5:23153625-23153647 CACCACAGCCTCGACCTTCCAGG + Intergenic
987848792 5:23322748-23322770 CACCAGGGCCTGCAACAGGCTGG + Intergenic
989186537 5:38631744-38631766 CTCCACAGCCTGGATCGGCCAGG + Intergenic
990027117 5:51206243-51206265 CACCACAACCTCGAACTTCCAGG - Intergenic
991165040 5:63556208-63556230 CACTGCAGCCTGGAACTGCTGGG - Intergenic
991488064 5:67158493-67158515 CACCACAGCCTCGAACTCCTGGG - Intronic
991717404 5:69464607-69464629 CACCACAGCCTTGAACTCCTGGG - Intergenic
991978727 5:72209929-72209951 CACTACAGCCTTGAACTTCCGGG - Intergenic
992026052 5:72669949-72669971 CACCACAGCCTTGACCTCCCAGG - Intergenic
992056875 5:72998901-72998923 CACTGCAGCCTGGAACTGCTGGG + Intronic
992346613 5:75885623-75885645 CACTACAGCCTGGAACTCCTAGG + Intergenic
992997576 5:82348085-82348107 CACCACAGCCTTGAACCCCCAGG + Intronic
993364087 5:87014962-87014984 CACCAAAGCCTTGAACTTCTGGG + Intergenic
993572281 5:89556277-89556299 CAGAAGACACTGGAACTGCCAGG + Intergenic
993608334 5:90022611-90022633 CACCAGAGCCTGACATTGTCAGG - Intergenic
994217371 5:97153060-97153082 CACTGCAGCCTGGAACTCCCAGG + Intronic
994258995 5:97634739-97634761 CACCGTAGCCTGGAACTCCTGGG - Intergenic
995111590 5:108435109-108435131 CACTAAAGCCTTGAACTGCTGGG + Intergenic
995491988 5:112703347-112703369 CACCGCAGCCTGGAACTCCTGGG + Intergenic
995531005 5:113091807-113091829 CACCATGGCCTTGACCTGCCAGG - Intronic
996363607 5:122677116-122677138 CACCAGAGCCTTGACCTCCTGGG + Intergenic
996905759 5:128597642-128597664 CAGCAGAGCCTGGAGCTGATGGG + Intronic
997212304 5:132084320-132084342 CACCTTAGCCTTGAACTGCCGGG - Intergenic
997306477 5:132840751-132840773 CTTCTGAGCCTGGTACTGCCAGG - Intergenic
997373322 5:133377107-133377129 CTCCACAGCCTGGAGCTGGCAGG - Intronic
997373821 5:133382963-133382985 GAACAGAGCGTGCAACTGCCTGG + Intronic
997419456 5:133754700-133754722 CCCCAGAGCGTGGACCTGACAGG - Intergenic
997627586 5:135341506-135341528 CCCCAGAGCCTGGTACTGGTGGG + Intronic
998012654 5:138707821-138707843 CACCATATCCTGGAACTTCTGGG + Intronic
998557990 5:143144479-143144501 CACCACAGCCTTGAACTCCCAGG + Intronic
999091668 5:148941474-148941496 CCCCAGGGCCTTGACCTGCCTGG + Intronic
1000086538 5:157892560-157892582 CACCACAGCCTAGAACTCCTGGG + Intergenic
1000779243 5:165459767-165459789 CACTACAGCCTGGAACTCCTGGG + Intergenic
1001074104 5:168611874-168611896 CACCACAGCCTTGAACTTCTGGG + Intergenic
1001720436 5:173852596-173852618 CACCACAGCCTTGAACTCCTGGG - Intergenic
1002513333 5:179737870-179737892 CACTACAGCCTTGAACTGCTGGG + Intronic
1002608926 5:180401129-180401151 CACTACAGCCTGGAACTCCTGGG + Intergenic
1002866921 6:1129972-1129994 CACCACAGCCTTGAACTCCTGGG - Intergenic
1003607907 6:7581471-7581493 AACCGGACCCTGGAACTGCAGGG + Exonic
1004191607 6:13468905-13468927 CACCATAGGCTTGATCTGCCTGG - Intronic
1004512835 6:16296747-16296769 CACCACAGCCTTGACCTCCCGGG + Intergenic
1004769333 6:18764006-18764028 CACCTGAGCCTGGAAGTTCAAGG - Intergenic
1005345945 6:24890728-24890750 CACTAAAGCCTGGAACTCCTGGG + Intronic
1005346111 6:24892344-24892366 CACTAAAGCCTGGAACTCCTGGG + Intronic
1006070177 6:31492721-31492743 CACTGCAGCCTGGAACTCCCCGG + Intergenic
1006698104 6:35948967-35948989 CAGCAGACACTGAAACTGCCAGG + Intronic
1006865937 6:37208973-37208995 CACTGGAGCCTTGAACTTCCAGG - Intergenic
1007438476 6:41836000-41836022 CACAACAGCCTGGAACTCCTGGG - Intronic
1007557510 6:42779139-42779161 CACTATAGCCTGGAACTCCTGGG - Intronic
1007570974 6:42890682-42890704 CAGCAGGGCCAGGAACTCCCGGG - Exonic
1007760469 6:44130512-44130534 CACTGCAGCCTGGAACTCCCTGG + Intronic
1008017662 6:46540256-46540278 CACTACAGCCTGGAACTTCTAGG + Intergenic
1008184860 6:48376270-48376292 CACTGGAGCCTAGAACTGCCGGG - Intergenic
1008299980 6:49824694-49824716 CACTAGAGCCTTGAACTCCCGGG - Intergenic
1008606199 6:53141926-53141948 CACCACAGCCTTGAATTCCCGGG - Intronic
1009631944 6:66211020-66211042 CACCACAGCCTGCACCTGTCGGG - Intergenic
1009872183 6:69466938-69466960 CACCAGTGCCTGGACATGACAGG - Intergenic
1010409172 6:75541312-75541334 CACCACAGCCTTGAACTCCTGGG + Intergenic
1011418482 6:87147784-87147806 CACTACAGCCTGGATCTGCTAGG - Intergenic
1011491075 6:87893007-87893029 CACCACAGCCTCGACCTCCCAGG - Intergenic
1012343507 6:98157175-98157197 CAGCAGGGCCTGGAACTCCAGGG - Intergenic
1012512661 6:100022228-100022250 CACTAAAGCCTGGAAATGCCAGG + Intergenic
1012624708 6:101392355-101392377 CACCAGGGACTGGAACTGCTAGG + Intergenic
1012943642 6:105443128-105443150 CACTGGAGCCTTGAACTCCCTGG + Intergenic
1013205291 6:107939205-107939227 CACTACAGCCTCGAACTGCTGGG - Intronic
1013548172 6:111180729-111180751 CACCACAGCCTTGAACTCCTGGG - Intronic
1013623544 6:111914972-111914994 CACCAAAGCCTGGAACTCTTGGG + Intergenic
1013776082 6:113679614-113679636 CACCACAGCCTTGAACTCCTGGG - Intergenic
1013944650 6:115706979-115707001 CTCCAGGGCCTGGCACTGCTGGG + Intergenic
1014473499 6:121844682-121844704 CACCACAGCCTTGAACCTCCAGG - Intergenic
1015156428 6:130101604-130101626 CACCAGGGCCTGGAAAGGGCAGG + Intronic
1015723798 6:136277600-136277622 CACCACAGCCTTGAACTCCTGGG + Intronic
1015984518 6:138872048-138872070 CACCATAGCCTTGAACTCCTGGG + Intronic
1016380698 6:143475576-143475598 CACCATAGCCTCAACCTGCCAGG - Intronic
1016383470 6:143508963-143508985 CACCACAGCCTTGAACTCCTGGG + Intronic
1017519135 6:155186255-155186277 CACCAAAGCCCAGAACTCCCTGG - Intronic
1017863471 6:158421421-158421443 CACCATAGCCTGGAACCTCCCGG - Intronic
1017869919 6:158478638-158478660 CACCCCACCCTGCAACTGCCTGG + Intronic
1017912833 6:158809019-158809041 CACCACAGCCTTGAACTCCTGGG - Intronic
1018610520 6:165643676-165643698 CACCAGAGGCTGGGACAGGCAGG + Intronic
1019314480 7:378095-378117 CACCGCAGCCTGGAACTCACGGG + Intergenic
1019356330 7:581789-581811 CACCACAGCCTTGAACTCCTGGG + Intronic
1019358248 7:592098-592120 GATCAGAGCCGGGACCTGCCTGG - Intronic
1019597829 7:1866485-1866507 CCCCAGAGACTGGAACCGTCTGG - Intronic
1019602832 7:1893793-1893815 CACCAGGGTCAGGAGCTGCCCGG + Intronic
1019661298 7:2225409-2225431 CACCAGTGCCAGGAACTACGAGG - Exonic
1019678909 7:2333484-2333506 CACCACAGCCTTGAACTGCTGGG - Intronic
1020095281 7:5365185-5365207 CACCACAGCCTCAAGCTGCCAGG + Intronic
1020166188 7:5809348-5809370 CACTATAGCCTGGACCTCCCAGG + Intergenic
1021391961 7:20103630-20103652 CACCATAACCTGGAACTCCTGGG - Intergenic
1021535625 7:21701363-21701385 CACCACAGCCTCGACCTTCCTGG + Intronic
1021665233 7:22970418-22970440 CACAAGAGCTTAGAAGTGCCTGG - Intronic
1021724009 7:23532389-23532411 CACCACAGCCTCAAACTCCCGGG + Intergenic
1021983633 7:26078586-26078608 CACTGCAGCCTGGAACTCCCTGG - Intergenic
1022260006 7:28695149-28695171 CACTGCAGCCTGGAACTACCGGG - Intronic
1022860383 7:34361101-34361123 CACCAGAGCCTGGACCTAGGTGG - Intergenic
1023124197 7:36938950-36938972 CACTGCAGCCTGGAACTCCCTGG - Intronic
1023140195 7:37094411-37094433 CACCAGGTCCTGGAAAGGCCAGG + Intronic
1023519817 7:41039096-41039118 CACCACAGCCTCAAACTCCCAGG + Intergenic
1023605417 7:41926875-41926897 CACTACAGCCTGGACCTCCCAGG + Intergenic
1023892168 7:44400699-44400721 CACCAGAAGCTGGAAATGGCAGG - Intronic
1024368251 7:48548865-48548887 CACCTGTGCCTGGCACTGACAGG - Intronic
1025093088 7:56078970-56078992 CACTACAGCCTCAAACTGCCAGG + Intronic
1025204257 7:56982643-56982665 CACCAGAGGCTGGAAGGGGCAGG + Intergenic
1025667682 7:63594291-63594313 CACCAGAGGCTGGAAGGGGCAGG - Intergenic
1025875280 7:65475918-65475940 AACCACATCCTGTAACTGCCTGG - Intergenic
1026260417 7:68750273-68750295 CACTGCAGCCTGGAACTTCCGGG + Intergenic
1026419659 7:70220994-70221016 CACTACAGCCTGCAACTGCTGGG + Intronic
1026584924 7:71648344-71648366 CACCGCAGCCTGGAACTCCTGGG + Intronic
1026600837 7:71776026-71776048 CACTACAGCCTGGAACTCCTGGG + Intergenic
1026604516 7:71804430-71804452 CACTAAAGCCTGGAATTCCCAGG - Intronic
1026627149 7:72005402-72005424 CACTACAGCCTGGAACTCCCAGG + Intronic
1026715133 7:72782211-72782233 CACCACAGCCTTGAACTCCTGGG - Intronic
1026778248 7:73245491-73245513 CACTGCAGCCTGGAACTCCCTGG + Intergenic
1027396708 7:77763766-77763788 CACTGCAGCCTGGACCTGCCAGG + Intronic
1027764275 7:82320485-82320507 CACCACAGCCTTGAACTTCTGGG + Intronic
1028558472 7:92147805-92147827 CACCACAGCCTCGACCTCCCAGG + Intronic
1029159105 7:98539072-98539094 CACCACAGCCTCGAACTCCTGGG - Intergenic
1029255569 7:99267302-99267324 CACTACAACCTGGAACTCCCAGG + Intergenic
1029359787 7:100080416-100080438 CACCATAGCCTGGAACTCCTGGG - Intronic
1029422945 7:100480721-100480743 CACCACAGCCTGGAACTCCTGGG + Intergenic
1029512942 7:101008200-101008222 CACCACAGCCTCGAACTCCTGGG + Intronic
1029657347 7:101936036-101936058 CCTCAGGGCCTGCAACTGCCTGG - Intronic
1029700700 7:102245116-102245138 CACCGCAGCCTTGAACTCCCAGG + Intronic
1030109439 7:106014034-106014056 CACCACAGCCTTGAACTCCTAGG + Intronic
1030182012 7:106719944-106719966 CACCAGGTCTTGGAACTGACGGG + Intergenic
1030618966 7:111769054-111769076 CACCAGACACTGTATCTGCCAGG + Intronic
1030791078 7:113729751-113729773 CACTGCAGCCTGGACCTGCCGGG - Intergenic
1030940754 7:115646152-115646174 CACCGCAGCCTGGACCTCCCAGG - Intergenic
1031086847 7:117310505-117310527 CACTAGAGCCTGGACCTCCTGGG - Intronic
1031313878 7:120232903-120232925 TACCAGAACCTGAACCTGCCTGG - Intergenic
1031405311 7:121378393-121378415 CACCACAGCCTGGAACTCCTGGG + Intronic
1031501627 7:122525062-122525084 CACCACAGCCTGGACCTCCTAGG - Intronic
1031667188 7:124499162-124499184 CACCATAGCCTTGAACTCCTGGG + Intergenic
1031745256 7:125487906-125487928 CACCAAAGCCTCGATCTTCCAGG - Intergenic
1033114920 7:138616860-138616882 CATCACAGCCTCGAACTCCCAGG + Intronic
1034538558 7:151741135-151741157 CACTAGAGCCTGGACCTCCCGGG - Intronic
1035161660 7:156954988-156955010 CACTGGGGCATGGAACTGCCTGG + Intronic
1035667841 8:1392168-1392190 CACCCGAGCCTGGAACTCAGGGG - Intergenic
1035700864 8:1638601-1638623 CACCTGTGCCTGGCACAGCCCGG - Intronic
1035723272 8:1808994-1809016 CACCACAGCCTGGAACTCCTGGG + Intergenic
1035738141 8:1904019-1904041 CACCACAGCCTGGACCTCCCAGG - Intronic
1038211359 8:25521836-25521858 CACTGCAGCCTTGAACTGCCAGG - Intergenic
1038942606 8:32322100-32322122 CACTACAGACTGGAACCGCCAGG - Intronic
1039112090 8:34051568-34051590 CACCACTGCCTGGAACACCCTGG + Intergenic
1039374876 8:37023359-37023381 CTCCACACCCTGGAACAGCCAGG - Intergenic
1039528550 8:38238103-38238125 CATCAGACCCTGCAACTGGCTGG - Exonic
1039844582 8:41316767-41316789 CACAGGGGCCTGGAAGTGCCAGG + Intergenic
1039937053 8:42053833-42053855 CACTGCAGCCTGGAACTCCCGGG - Intergenic
1040484366 8:47855989-47856011 CTCAAGAGAGTGGAACTGCCGGG - Intronic
1040605554 8:48927868-48927890 CACCAGACTCTGAATCTGCCCGG + Intergenic
1042219829 8:66462323-66462345 CACCACAGCCTTGACCTCCCAGG + Intronic
1042558651 8:70055579-70055601 CACTGCAGCCTGGAACTCCCAGG + Intronic
1042826885 8:72988808-72988830 CACCACAGCCTTGATCTCCCAGG - Intergenic
1042971288 8:74411804-74411826 CACCACAGCCTCGACCTCCCAGG - Intronic
1042975382 8:74463383-74463405 CACCGCAGCCTAGAACTCCCGGG - Intronic
1043374399 8:79632156-79632178 CACCACTGCCTGGAAATGACAGG + Intronic
1043423304 8:80122771-80122793 ACCAAGAGCCTGGAACTGCACGG + Intronic
1043438638 8:80257753-80257775 CACCACAGCCTTGACCTCCCTGG + Intergenic
1043854117 8:85245431-85245453 CACCAGAGCCTGGAACTGCCAGG - Intronic
1043920988 8:85983204-85983226 CACCAAAGCCTGGCTCTTCCAGG + Intergenic
1044168525 8:89019505-89019527 CACTGTAGCCTGGAACTCCCTGG - Intergenic
1044701549 8:94969563-94969585 CACCGCAGCCTTGAACTCCCAGG - Intronic
1044982291 8:97728985-97729007 CACTTCAGCCTGGAACTCCCGGG + Intergenic
1045099993 8:98834581-98834603 CACCAGACACTGAATCTGCCAGG - Intronic
1045470723 8:102509828-102509850 CACTATGGCCTGGAACTCCCAGG - Intergenic
1045477086 8:102562341-102562363 CACCTGAACTTGGATCTGCCTGG + Intergenic
1045990314 8:108298879-108298901 CACCACAGCCTTGACCTCCCAGG + Intronic
1046061545 8:109145595-109145617 CACTATAGCCTTGAACTACCAGG + Intergenic
1047192604 8:122691769-122691791 CACCAGAGGATGGAACTCCAAGG + Intergenic
1047671151 8:127148844-127148866 CACTGTAGCCTGGAACTGCTGGG - Intergenic
1047704706 8:127486173-127486195 CACTGCAGCCTGGAACTCCCGGG - Intergenic
1047961968 8:130017139-130017161 CTCCAGGGCCTAGAACAGCCCGG - Intergenic
1048254362 8:132894532-132894554 CACCACAGCCTCGAACTCCTGGG + Intronic
1048338225 8:133518903-133518925 CTCCAGAGCCTTGCACTGCTGGG - Intronic
1048347738 8:133590168-133590190 CACCAAAGCCTTGAACTCCTGGG + Intergenic
1048578406 8:135710800-135710822 CACCACAGCCTGGAACGCCTGGG + Intergenic
1049056399 8:140240646-140240668 CACTACAGCCTGGAACTCCTGGG + Intronic
1049093692 8:140535305-140535327 CCCCAGCGCCTGGCACAGCCTGG + Intronic
1049345568 8:142136790-142136812 CACCAGGGCCAGGACCTCCCTGG + Intergenic
1049454961 8:142682119-142682141 CCCCAGAGCCTAGAGCTGGCCGG - Exonic
1049531919 8:143159361-143159383 CTCCAGGGCCTGGAACTGGTGGG - Intronic
1049695585 8:143982986-143983008 CACCACCTCCTGGAACTCCCCGG + Exonic
1050149224 9:2602406-2602428 CACCACAGCCTTGAACTCCTGGG + Intergenic
1050556242 9:6791944-6791966 CACCACAGCCTCGACCTCCCGGG - Intronic
1050720552 9:8584076-8584098 CACTACAGCCTCGAACTACCAGG - Intronic
1051733136 9:20168830-20168852 CACCTGAGAGTGAAACTGCCGGG - Intergenic
1052127802 9:24799500-24799522 CACCACAGCCTGGATATGCTGGG - Intergenic
1054767620 9:69055283-69055305 TACTAGAGCCTGTAACTGCAGGG + Intronic
1056265645 9:84894100-84894122 CACCAGTGCATGCAATTGCCAGG - Intronic
1056509411 9:87288917-87288939 CACCATAGCCTCGAACTCCTGGG + Intergenic
1057757683 9:97851160-97851182 CACTACAGCCTGGAACTCCTGGG + Intergenic
1057805202 9:98215005-98215027 CGCCAGGGGTTGGAACTGCCTGG - Intronic
1057805633 9:98217786-98217808 CACCACAGCCTCGAACTCCTGGG + Intronic
1057811583 9:98261338-98261360 CACCACAGCCTTGACCTCCCAGG + Intergenic
1057895343 9:98904468-98904490 CACCAGAGCCAAGGACAGCCAGG + Intergenic
1058038938 9:100283226-100283248 CACCGCAGCCTTGAACTCCCAGG - Intronic
1058700061 9:107592580-107592602 AGCCTGAGCCTGGATCTGCCTGG - Intergenic
1059095624 9:111410590-111410612 CACCGCAGCCTGGACCTCCCAGG + Intronic
1059146399 9:111903669-111903691 CACCACAGCCTTGACCTCCCAGG + Intronic
1059484691 9:114617644-114617666 CACTGGAGCCTGGAACTCCTGGG + Intronic
1059499945 9:114743644-114743666 CACCACAGCCTTGACTTGCCAGG - Intergenic
1060491346 9:124087295-124087317 CACCACAGCCTCGACCTCCCGGG - Intergenic
1060593094 9:124831724-124831746 CACCGGTGCCTGGAGCTGGCAGG - Intergenic
1060741550 9:126101407-126101429 CACCACAGCCTTGACCTCCCAGG - Intergenic
1061148065 9:128811921-128811943 CACCAGAGCCTGGGAATTCAAGG - Intergenic
1061336386 9:129940123-129940145 CACTATAGCCTCGAACTCCCGGG - Intronic
1061407016 9:130398075-130398097 CACTATAGCCTGAAACTCCCGGG - Intronic
1061503116 9:131014905-131014927 CACTACAGCCTCGAACTCCCAGG - Intronic
1061523239 9:131135163-131135185 CACAGAAGCCTGGAACTCCCAGG + Intronic
1061598875 9:131652324-131652346 CACCACAGCCTGGAATTCCTGGG + Intronic
1061696299 9:132376735-132376757 CACTGAAGCCTGGAACTCCCAGG + Intronic
1062016346 9:134293156-134293178 GACCAGGGCCTGGGACTGCCGGG - Intergenic
1062555547 9:137112111-137112133 CGCCAGGGCCTGGGACTACCAGG - Exonic
1062620083 9:137416715-137416737 AACCAGGTCCTGGAACCGCCTGG - Intronic
1062663222 9:137650983-137651005 CACCGCAGCCTCGAACTCCCAGG - Intronic
1185869277 X:3650063-3650085 CACCACAGCCTCGAACTTGCAGG - Intronic
1186062317 X:5722768-5722790 CACCACAGCCTTGATCTCCCGGG + Intergenic
1186163891 X:6806400-6806422 CACCATAGTCTTGAACTCCCTGG + Intergenic
1186284808 X:8032183-8032205 CACTACAGCCTTGAACTCCCAGG - Intergenic
1186473845 X:9841981-9842003 CACTACAGCCTGGAACTCCCAGG - Intronic
1187502203 X:19848847-19848869 CACTAGAGCCTGGAACTCCTGGG + Intronic
1188244183 X:27821008-27821030 CCACAAAGCCTGGACCTGCCAGG + Intronic
1189448470 X:41104140-41104162 CACTATAGCCTTGAACTCCCAGG + Intronic
1189508515 X:41637717-41637739 CACCACAGCCTCGACCTCCCTGG + Intronic
1189535701 X:41933375-41933397 CACCACAGCCTTGAACTCCTGGG - Intergenic
1189591467 X:42517078-42517100 CACTACAGCCTTGATCTGCCAGG + Intergenic
1189914860 X:45847127-45847149 CATCACAGCCTTGACCTGCCAGG + Intergenic
1189998800 X:46664825-46664847 CACTATAGCCTGGAACTCCTGGG + Intronic
1190268648 X:48845348-48845370 CACCACAGCCTCGACCTCCCAGG - Intergenic
1190824656 X:54006404-54006426 CACCACAGCCTTGACCTCCCAGG - Intronic
1192094703 X:68198364-68198386 CACCAGACACTGAAACTGCTTGG + Intronic
1192503020 X:71665598-71665620 CGCCACAGCCTGGGACTCCCTGG + Intergenic
1192592583 X:72372957-72372979 CTCCAGGGCCTAGAACTGGCAGG - Intronic
1196272055 X:113723787-113723809 CACTACAGCCTGGAACTCCTGGG - Intergenic
1196338064 X:114562662-114562684 AACCAGAGCCAAGTACTGCCTGG + Intergenic
1196960405 X:120994172-120994194 CACCATAGCCTCGAACTCCCAGG + Intergenic
1197603776 X:128560928-128560950 CACCACAGCCTGCAACACCCTGG + Intergenic
1197741275 X:129896149-129896171 CACCACAGCCTCAAACTCCCAGG - Intergenic
1198367510 X:135956806-135956828 CACTGCAGCCTGGAACTCCCAGG + Intergenic
1200087393 X:153614374-153614396 CACCACAGCCTCGACCTCCCGGG + Intergenic
1200184277 X:154171518-154171540 CACTACAGCCTTGAACTCCCGGG - Intergenic
1200201336 X:154283576-154283598 CACTACAGCCTTGAACTCCCGGG - Intronic
1200785499 Y:7257081-7257103 CACCACAGCCTTGACCTCCCAGG - Intergenic
1200795038 Y:7333277-7333299 CACCGCAGCCTGGAACTCCCAGG + Intergenic
1201342569 Y:12950638-12950660 CACCACAGCCTCAAACTGCTGGG + Intergenic
1201558390 Y:15288956-15288978 AACCACAGCCTGGAACTTCTTGG - Intergenic
1201898374 Y:19018826-19018848 CACCATAGCCTTGAACTTCTGGG - Intergenic
1202092108 Y:21202894-21202916 TACCAGAGCCTGGAAATGATAGG - Intergenic