ID: 1043856892

View in Genome Browser
Species Human (GRCh38)
Location 8:85274592-85274614
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 4, 1: 9, 2: 2, 3: 22, 4: 253}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043856892_1043856897 21 Left 1043856892 8:85274592-85274614 CCCACCTTCTTCTGCTAATAAGT 0: 4
1: 9
2: 2
3: 22
4: 253
Right 1043856897 8:85274636-85274658 GAAAAATTGCCGCAAGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043856892 Original CRISPR ACTTATTAGCAGAAGAAGGT GGG (reversed) Intronic
900801359 1:4738933-4738955 ACTTAGGAGGAGAAGGAGGTGGG + Intronic
901727832 1:11256137-11256159 ACTTGCTGGAAGAAGAAGGTAGG + Exonic
904354431 1:29929938-29929960 ATTTATTTGCAGAAGAAACTGGG + Intergenic
904593362 1:31627655-31627677 GGTTAGGAGCAGAAGAAGGTGGG + Intronic
907585857 1:55617247-55617269 ACTTATTTTCAGAAAAAGGGGGG + Intergenic
908138566 1:61158909-61158931 ACTTAATAGTTGAAGAATGTGGG + Intronic
910602760 1:89049576-89049598 CCTGATTAGCAGAGGCAGGTGGG - Intergenic
912067021 1:105756945-105756967 AGTTATATGCAGAAGAAGGCAGG - Intergenic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
917581121 1:176378938-176378960 ACTCATCACCAGAAGAAGGTTGG - Intergenic
917872867 1:179257355-179257377 ACCTCTTGGCAGAACAAGGTGGG - Intergenic
918454911 1:184700225-184700247 ACTTATCAGAAGAAGAAGACAGG + Intronic
920653461 1:207855979-207856001 GCTTGTTGGCAGAAGGAGGTTGG - Intergenic
921610106 1:217202771-217202793 ACTAATTAACAGAAAAAGGGAGG - Intergenic
1066566733 10:36729180-36729202 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1067551528 10:47239837-47239859 GCTTATTAACAGCAGAAAGTAGG - Intergenic
1068148032 10:53096699-53096721 ACTCATTAACAGAAAGAGGTTGG + Intergenic
1068603256 10:58977951-58977973 ACATATTAGTGGAGGAAGGTAGG + Intergenic
1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1080027481 11:27629522-27629544 TCTTATTAATAGAAGAAGGCAGG - Intergenic
1082635346 11:55586833-55586855 ACTTATTAGCAGAAGAAGGTGGG + Intergenic
1085064591 11:73482444-73482466 ACTTATGACCAGCAAAAGGTGGG - Intronic
1085303141 11:75470146-75470168 ACTTATTGAGAGAACAAGGTTGG + Intronic
1085380575 11:76113775-76113797 ATTTATAAGAGGAAGAAGGTTGG + Intronic
1085685960 11:78622162-78622184 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1085780838 11:79407539-79407561 ACTTATTAGCAGCAGGATCTTGG - Intronic
1086884709 11:92191927-92191949 AGTTATTAGCAAAAAAAGATGGG - Intergenic
1087048262 11:93862565-93862587 ACTTATTAGCAGAAGAGGGTGGG - Intergenic
1087294551 11:96355589-96355611 ACTTACTAGCAGTAGAATTTGGG - Intronic
1087426759 11:97998019-97998041 ACTTATTAGGTGAAAGAGGTAGG + Intergenic
1087432664 11:98073502-98073524 ACTTATTAAGGGAAGAATGTTGG + Intergenic
1087965064 11:104402959-104402981 GCTGATTAGCAGAAGGAGGTGGG - Intergenic
1092162927 12:6325894-6325916 ACTTCTTACCATAAGAAAGTGGG - Intronic
1093284688 12:17244315-17244337 ACTCATGAGCAAAAGAAGGGAGG - Intergenic
1093359264 12:18203207-18203229 TCTTATTAGTATAAGAAGGCAGG + Intronic
1095395572 12:41758460-41758482 TCTTGTTAGCAAAAGTAGGTAGG - Intergenic
1095775107 12:46002085-46002107 ACTTACTAGAAGAAGGAGGTTGG + Intergenic
1097267380 12:57754256-57754278 AGTAATTAACAGAAGAAGGGAGG - Intronic
1097422130 12:59392951-59392973 ACTTGTTAACAGAACAAGGCAGG + Intergenic
1097821385 12:64132191-64132213 AGTTATCTGCAGAAGAAGGCAGG + Intronic
1097951367 12:65432566-65432588 CCTTTTTAGCAGATGAAGATAGG + Intronic
1099489047 12:83265441-83265463 ACTTATTAGCTGTAGAATCTTGG - Intergenic
1099862226 12:88234727-88234749 ACTTATTAGCAGAAGAGGGTGGG + Intergenic
1100286867 12:93174955-93174977 CCTTATTTCCAGGAGAAGGTGGG - Intergenic
1100492199 12:95091779-95091801 ACTTATTAGACGAACAAGCTTGG + Exonic
1101082125 12:101197592-101197614 ACATATTTGCAGAAGAAACTGGG - Intronic
1106160987 13:27201313-27201335 ACTTATTTTCAGAAGAAACTCGG + Intergenic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1109803388 13:67405026-67405048 ACTTGCTAGCAGCTGAAGGTGGG + Intergenic
1110467063 13:75814312-75814334 ACATATTAGCAGCACAAGGCAGG - Intronic
1112028762 13:95438212-95438234 ACTTATAAGCAAAAGTAGCTGGG - Intronic
1112114783 13:96339902-96339924 AATTATTTCCAGAAGGAGGTGGG + Intronic
1112941068 13:104862432-104862454 ACTCAGTAGTAGAAGGAGGTGGG + Intergenic
1114165643 14:20215944-20215966 ACTTATTAGCTGTAGGAGCTTGG - Intergenic
1115394083 14:32887435-32887457 ACAGATCAGCAGAGGAAGGTAGG - Intergenic
1116008567 14:39324311-39324333 GCTCATTAGAAGAAGAAGGCTGG - Intronic
1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1117163737 14:53013820-53013842 ACTTATTTGCATAAGAACCTTGG + Intergenic
1117447677 14:55820420-55820442 ACTTACTAGCAGCTGAAGGAGGG - Intergenic
1118020223 14:61704544-61704566 ACTTGTTAGCAGAGGAAAGTTGG + Intronic
1118725048 14:68623078-68623100 TCTTATGAGAAAAAGAAGGTAGG - Intronic
1119229021 14:72965747-72965769 ACTTATCAGCAGAAGACCTTGGG - Intergenic
1120253331 14:82087738-82087760 ACTAATTTGAAGAAGAAGGGGGG + Intergenic
1120738752 14:88084060-88084082 ACATAATAGTAGCAGAAGGTGGG - Intergenic
1122638178 14:103139966-103139988 ACATAATACCAGAAGAAGGGGGG - Intergenic
1123202345 14:106678658-106678680 ACTTATTTGTTGATGAAGGTTGG - Intergenic
1123389282 15:19853355-19853377 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1129172286 15:73815560-73815582 ACTTATTAGCAGCAAAAGCCAGG + Intergenic
1129967989 15:79753844-79753866 ACTTATTAGCAGAAGACCTTGGG - Intergenic
1133766027 16:8838403-8838425 TCTTATTAACATAAGAAGGCAGG - Intronic
1133869055 16:9670980-9671002 TCTTATTAATATAAGAAGGTAGG - Intronic
1135844198 16:25903577-25903599 ACTTATTAGAAGCAAAAGGGAGG + Intronic
1137070791 16:35903118-35903140 ACTTATTAGCAGAAGAGAGTGGG - Intergenic
1138267167 16:55667900-55667922 ACTTATCAGCAGGATAAGGTCGG + Intronic
1140121327 16:72085367-72085389 ATTTATTAGAAGGAGAGGGTAGG - Exonic
1144105005 17:11976489-11976511 TCTTATTAATAGAAGAAGGCAGG + Intergenic
1146306386 17:31732891-31732913 ACCGATTAGCAGCAGCAGGTGGG - Intergenic
1146662280 17:34672779-34672801 ACTTCTTCCCACAAGAAGGTGGG - Intergenic
1146902865 17:36599746-36599768 ACCTATGAGCAAATGAAGGTGGG + Exonic
1146980383 17:37155513-37155535 ACTTATTAGCTGAAGAACCTTGG - Intronic
1148425952 17:47596182-47596204 ACTTAGTTGCAGAAGAGGGGTGG + Intronic
1149301702 17:55310433-55310455 AATTATTAGTAAAACAAGGTTGG + Intronic
1150435974 17:65154532-65154554 ACTATTTAGCAGAAAAAAGTTGG + Intronic
1150943741 17:69722089-69722111 TCTTATTAGCAGAAGGGGTTGGG - Intergenic
1150943756 17:69722289-69722311 CCTTATTAGCAGAAGGGGTTGGG - Intergenic
1151929818 17:77225291-77225313 CCTTATTAGCAGAATGAGGATGG - Intergenic
1152201807 17:78951784-78951806 ACTTCTAGGCAGGAGAAGGTGGG + Intergenic
1154532598 18:15362757-15362779 CCTGATTAGCAGGAGGAGGTAGG + Intergenic
1155090462 18:22504253-22504275 ACTTGCAAGCAGAAGATGGTGGG - Intergenic
1155657565 18:28209695-28209717 ACTTATTAGCAGAAAAAGGTGGG - Intergenic
1156302784 18:35849956-35849978 TCTTATTAACATAAGAAGATAGG + Intergenic
1158277181 18:55780794-55780816 CCTTATTAGGAGGAGTAGGTGGG + Intergenic
1160033697 18:75282814-75282836 ACTTATTAGCACACACAGGTTGG + Intronic
1162615788 19:11799054-11799076 AATTTTTAGCAGAAGAAAGGCGG - Intronic
1163942813 19:20510739-20510761 ACTTACTAGCAGCTGAAGGAGGG - Intergenic
1164237523 19:23350124-23350146 ACTTATTAGCAGAAAAAGGTGGG + Intronic
1165070527 19:33252769-33252791 CTTTACTGGCAGAAGAAGGTTGG + Intergenic
1168498907 19:56876918-56876940 TCTTATTAGAAGAAGAGGTTAGG + Intergenic
925811871 2:7709017-7709039 GCTGTTTAGCATAAGAAGGTGGG - Intergenic
926278618 2:11425739-11425761 ACTTATTAGCAGAAGAGGGTGGG + Intergenic
927008714 2:18879693-18879715 ACTTATCTGCAGAAGATGGCAGG - Intergenic
927577836 2:24215168-24215190 ACTGATGAGCAGAAGAAGAAAGG - Intronic
931014200 2:57956700-57956722 CCTTATTTGGAGAAGAAAGTAGG + Intronic
931101723 2:59009745-59009767 ACTTATTAGCAGTAAAATGTTGG + Intergenic
932137287 2:69242405-69242427 AGATATTGGCAGAAGAAGGCTGG + Intronic
933471301 2:82728965-82728987 ATTTATTTGGATAAGAAGGTGGG - Intergenic
933682475 2:85114317-85114339 CCTTATCATCAGAAGAAGATAGG + Intergenic
934164581 2:89282534-89282556 CCTTATAAAAAGAAGAAGGTGGG - Intergenic
934202693 2:89899990-89900012 CCTTATAAAAAGAAGAAGGTGGG + Intergenic
934665099 2:96164254-96164276 ACTTAGTAGCTGAGGAAAGTGGG - Intergenic
935183932 2:100714870-100714892 AGTTATTTTCAGAAGATGGTAGG - Intergenic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
935719724 2:105969330-105969352 ACTTATTAGCAGAAGAAGGTGGG - Intergenic
938531702 2:132193978-132194000 CCTGATTAGCAGGAGGAGGTAGG + Intronic
938876159 2:135532973-135532995 ACTTGTTAGCAGAATAAACTTGG + Intronic
939253698 2:139716210-139716232 ACTTACTAGCTGAATAAGCTTGG - Intergenic
939795900 2:146643625-146643647 CCTTAGAAGCAGAAGAAAGTGGG + Intergenic
943388126 2:187227107-187227129 AGTTATCTGCAGAAGATGGTAGG - Intergenic
943459752 2:188157140-188157162 ACTTATTAGTTCAAGGAGGTTGG + Intergenic
944454472 2:199878856-199878878 AATTCTTAGCAGAAGAGGGTGGG - Intergenic
944557464 2:200902013-200902035 ACTTATTAGGAGGAGATTGTGGG + Intronic
945466390 2:210174772-210174794 ATTTATTAGCATAAGAATCTAGG - Intergenic
1170426662 20:16241923-16241945 ACTTCTTAACAGCAGAAGGATGG - Intergenic
1174810655 20:53642690-53642712 ACAAATTAGAAGAAGAAGGAAGG - Intergenic
1175874751 20:62224098-62224120 CCTGATCAGCAGGAGAAGGTGGG + Intergenic
1176016044 20:62933347-62933369 AATGGTTAGCAGAAGTAGGTAGG - Intronic
1176335297 21:5592019-5592041 ACTTTTTAGCAGAATAAACTAGG + Intergenic
1176392460 21:6228929-6228951 ACTTTTTAGCAGAATAAACTAGG - Intergenic
1176468959 21:7087245-7087267 ACTTTTTAGCAGAATAAACTAGG + Intergenic
1176492520 21:7469023-7469045 ACTTTTTAGCAGAATAAACTAGG + Intergenic
1176508122 21:7669360-7669382 ACTTTTTAGCAGAATAAACTAGG - Intergenic
1176764760 21:13005452-13005474 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1177062455 21:16392558-16392580 TCTTATTAACAGAAGAAGACAGG - Intergenic
1177767747 21:25477339-25477361 ACATATTGACAGAATAAGGTGGG + Intergenic
1178012657 21:28305146-28305168 AGTTATCAGCAGAAGATGGCAGG - Intergenic
1178151533 21:29799997-29800019 TCTCATTTGCAGAAGAAGTTCGG - Intronic
1178448114 21:32663875-32663897 ACTTGCTAGCAGCTGAAGGTGGG + Intronic
1179120359 21:38539695-38539717 ACCCATTAGCAAAACAAGGTGGG - Intronic
1179413645 21:41180838-41180860 ATTTACTAGCTGAACAAGGTGGG - Intronic
1180511945 22:16100245-16100267 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
951591889 3:24275346-24275368 ATTTAATAGATGAAGAAGGTGGG - Intronic
953154795 3:40359891-40359913 ACTTATTCTCAGAAGAAGTCTGG - Intergenic
953225261 3:41013096-41013118 TCTGATTAGCAGAATAAGGAAGG - Intergenic
954759945 3:52866743-52866765 ACTGACTAGCAGAAGGAAGTTGG + Intronic
957311431 3:78524350-78524372 ATTTATTGGCAGAAGATGGAAGG + Intergenic
960874793 3:122285701-122285723 ACATAATAGCAGCAGCAGGTAGG - Exonic
961262845 3:125616393-125616415 AGTTATCTGCAGAAGATGGTAGG - Intergenic
961980918 3:131077438-131077460 ACAGTTTAGCAGATGAAGGTAGG - Intronic
962171052 3:133101527-133101549 AATTATTTCCAGATGAAGGTTGG - Intronic
963257711 3:143162341-143162363 ACAGATTAGCAGAAGAATGGTGG - Intergenic
963617779 3:147564700-147564722 TCTTATAAGCAGAATAAAGTTGG - Intergenic
964548569 3:157861607-157861629 ACATAGAAGCAGAAGAAGGGTGG + Intergenic
965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG + Intergenic
965872821 3:173281025-173281047 GCTTATTAGCAGAAGAGGGTGGG + Intergenic
969234710 4:5857697-5857719 ACTAGTAAGCAGAAGAAGGAAGG + Intronic
973160569 4:47011171-47011193 AAACATTAGCAGAAAAAGGTGGG + Intronic
973641647 4:52908837-52908859 ACTAATAAGCATAAAAAGGTTGG - Intronic
973898927 4:55446674-55446696 AATTATAAGCAGAAGAAAATAGG - Intronic
974148655 4:57977454-57977476 AATTATTTACAGAATAAGGTAGG + Intergenic
974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG + Intergenic
974413500 4:61573052-61573074 ACTTATTAGCACAGAAAGCTAGG + Intronic
975017259 4:69437749-69437771 AGCTATTAGGAGAAAAAGGTAGG - Intergenic
975317364 4:72970002-72970024 ACTTATTGGCAGAAGCAGGAGGG + Intergenic
975676634 4:76833618-76833640 TGCTATTACCAGAAGAAGGTGGG - Intergenic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
976337478 4:83907151-83907173 ACATATTAGAAGAAGAATGTGGG + Intergenic
977397423 4:96488188-96488210 GCTTGTTATCAGAAGAAGGAAGG + Intergenic
977590738 4:98823814-98823836 TCTTATTGGCAGCAGATGGTTGG + Intergenic
977701477 4:100027931-100027953 AATGAGTAGCAGAAGAAGGTAGG - Intergenic
977990927 4:103441659-103441681 ACTTGTTGGCAGAGGAAGGCAGG + Intergenic
978330173 4:107603925-107603947 ACTCATCAGCAGATGAAGGCTGG - Intronic
978485764 4:109252032-109252054 ACTTTATAGCAAAAGAAGTTGGG - Intronic
978875446 4:113635482-113635504 ACTTATTTTCAGAAAAAGGAAGG + Intronic
979227817 4:118309732-118309754 ACTTATTAGCAGAACTAGGGAGG + Intronic
979532569 4:121784821-121784843 ACAAATAAGCAGAAGGAGGTGGG + Intergenic
980991979 4:139745962-139745984 ATTTAGTAGCAGGAGAAAGTTGG - Intronic
983285006 4:165728151-165728173 AAGTATGAGCAGAAGAAAGTTGG + Intergenic
984331618 4:178327909-178327931 ATTTATGAGAAGAAGAAGATTGG + Intergenic
984776854 4:183489038-183489060 AAATATAAGCATAAGAAGGTTGG - Intergenic
986046430 5:4042674-4042696 ACTACTTAGAAGAAGAAGCTGGG - Intergenic
986426994 5:7642768-7642790 ACTTTTTAGCAGGAGAAATTGGG + Intronic
986559135 5:9043190-9043212 CCTAATTACCAGAATAAGGTTGG + Intronic
987456751 5:18156833-18156855 ACTAATTAACAGAAAGAGGTAGG - Intergenic
988178475 5:27758830-27758852 ACTAATTGCAAGAAGAAGGTGGG - Intergenic
988228766 5:28448097-28448119 ATTTATCTGCAGAAGATGGTAGG - Intergenic
989420146 5:41228492-41228514 ACTGAATAGAAGAAGAAAGTGGG + Intronic
989563904 5:42881958-42881980 TTCTATTAGCAGAAGAAGGAGGG - Intronic
990086969 5:51990590-51990612 ACTTATTTGCAGAAGACATTTGG - Intergenic
990357067 5:54978917-54978939 ACTTAAGAGCAGGAGAAGATGGG - Exonic
993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG + Intergenic
993461248 5:88185077-88185099 ACTTATTAGAAGAAAAAAGCAGG - Intergenic
994302372 5:98160739-98160761 ACCTCTTGGCAGAACAAGGTAGG + Intergenic
994733266 5:103520056-103520078 ACTTATGTGGAGAAAAAGGTGGG + Intergenic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
996650808 5:125873713-125873735 AATTCTGGGCAGAAGAAGGTGGG - Intergenic
999582286 5:153052303-153052325 AATTATTAACAGAAGGAGGAAGG + Intergenic
1000053641 5:157583753-157583775 ACTCACTAGCAGTAGAAGGAGGG - Intergenic
1000720466 5:164699851-164699873 ACTAATTAGTAAAAGTAGGTTGG + Intergenic
1003728766 6:8796339-8796361 ACAAATGCGCAGAAGAAGGTGGG + Intergenic
1004650957 6:17607298-17607320 TCTTATTAAAAGAAGTAGGTAGG - Intronic
1004848208 6:19669225-19669247 GAGTATTAGCAGAAGAAAGTTGG - Intergenic
1005058483 6:21753754-21753776 ACTTATTGGCAGATTAACGTAGG - Intergenic
1007014133 6:38446157-38446179 ACTTTCTAGCAGAAGTATGTGGG + Intronic
1008905132 6:56668989-56669011 ACTTATTAGCAGTATAAACTTGG + Intronic
1010126515 6:72438674-72438696 ACTCATTTGCAGATGAAGCTGGG - Intergenic
1011115070 6:83880885-83880907 ACTTATTTGCAGATGACTGTAGG - Intronic
1014197638 6:118577678-118577700 AAATATTAGCTGAAAAAGGTGGG + Intronic
1015426525 6:133076055-133076077 ACTTACTAGCAGAATAATGTGGG + Intergenic
1015466851 6:133557745-133557767 AGTTATCAGCAGAAGACGGCAGG + Intergenic
1015806915 6:137118987-137119009 AGTTATTTGCTGAAGAGGGTGGG + Intergenic
1016249327 6:142021307-142021329 TCTTATTAGTATAAGAAGGCAGG + Intergenic
1016292816 6:142542342-142542364 GCTTATTAGCAGAAGAAGGTGGG + Intergenic
1016519222 6:144928400-144928422 TCTTATTAGTACAAGAAGGCAGG + Intergenic
1016566157 6:145457158-145457180 ACTTATTAGCAGAAAAACTTTGG - Intergenic
1017016032 6:150100192-150100214 ACTTATCAGCAGAAGAAGGTGGG + Intergenic
1017389928 6:153926751-153926773 TCTTATTAATATAAGAAGGTAGG + Intergenic
1019897959 7:3997814-3997836 ACTCCTGGGCAGAAGAAGGTGGG - Intronic
1020121669 7:5507537-5507559 AATAATTAGCAGAACAAGGCCGG + Intronic
1021416804 7:20395817-20395839 ACTAATAAGCAGAAGAAAGTGGG + Intronic
1022373572 7:29792103-29792125 TCTTATTAATAAAAGAAGGTAGG + Intergenic
1022801227 7:33779429-33779451 TCTGATTAGCAGCAGATGGTGGG - Intergenic
1024054903 7:45653726-45653748 GGGTATGAGCAGAAGAAGGTGGG - Intronic
1025115511 7:56254763-56254785 ACTTATGAACAGAAGGAGGACGG - Intergenic
1026076340 7:67173289-67173311 ACTTATTTGTGGAAGAAGGTGGG + Intronic
1026209736 7:68293398-68293420 ATTTATTCGCAGAAAAATGTGGG - Intergenic
1026306059 7:69142966-69142988 CCATCATAGCAGAAGAAGGTGGG - Intergenic
1026700517 7:72638993-72639015 ACTTATTTGTGGAAGAAGGTGGG - Intronic
1027887590 7:83929346-83929368 ATTTATTATAAGTAGAAGGTAGG - Intergenic
1030804856 7:113903577-113903599 ACCTCTTAGCAGAAAAAGTTGGG + Intronic
1031437190 7:121747255-121747277 AGATATCAGCAGCAGAAGGTTGG - Intergenic
1032635297 7:133700702-133700724 TTTTATTAGCTGAAGGAGGTTGG + Intronic
1032712067 7:134469236-134469258 ACTTGTTAGCAGAAGAAGGTGGG + Intergenic
1033475588 7:141688972-141688994 AAGTATTAGAAGAAGCAGGTTGG - Intronic
1035685139 8:1518561-1518583 ATTTATTAGCTGATCAAGGTTGG - Intronic
1038369114 8:26970042-26970064 AATTATGGGCAGAAGAGGGTGGG - Intergenic
1041573149 8:59360720-59360742 ACTTATAAGCAGCAAATGGTAGG - Intergenic
1041706423 8:60850974-60850996 ACTGATAAGCAAAAGAAGGAAGG - Intronic
1041813839 8:61943881-61943903 ACTTATTGGAGGAAGATGGTTGG + Intergenic
1041916570 8:63145059-63145081 ACTTATTAGCAGAAGAAGGTGGG - Intergenic
1043054242 8:75417519-75417541 AGTTATTATCAGAAGAAACTGGG - Intronic
1043856892 8:85274592-85274614 ACTTATTAGCAGAAGAAGGTGGG - Intronic
1044133663 8:88558246-88558268 ACTTATTGACAGATGAGGGTGGG - Intergenic
1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1044361027 8:91283862-91283884 ACTTATTAGGACAAGAATTTTGG + Intronic
1044898654 8:96920709-96920731 ACTTATCAGAAGAAGAAATTTGG + Intronic
1045820722 8:106334868-106334890 ATTTATTAGCAGTAGTAGGATGG - Intronic
1046272580 8:111915867-111915889 CCTGATTAGCAGGAGGAGGTGGG + Intergenic
1046436524 8:114196507-114196529 AGTTATTTGCAGAAGATGCTAGG + Intergenic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1047185865 8:122632893-122632915 ACTTTTTGGAAGCAGAAGGTGGG - Intergenic
1050888738 9:10796784-10796806 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1050957636 9:11685638-11685660 ACTTATTACCAAAAGGAAGTGGG + Intergenic
1051360320 9:16276332-16276354 ACTAACTAGCAGCAGAAGGCGGG - Intergenic
1051769447 9:20560608-20560630 ACCTAATAGTAGAAGAAGCTGGG + Intronic
1053710310 9:40800474-40800496 CCTGATTAGCAGGAGGAGGTAGG + Intergenic
1053868851 9:42469421-42469443 AGTTATTCGCAGAAGATGGCAGG - Intergenic
1054087439 9:60759759-60759781 AGTTATTCGCAGAAGATGGCAGG + Intergenic
1054420217 9:64921269-64921291 CCTGATTAGCAGGAGGAGGTAGG + Intergenic
1055438646 9:76317719-76317741 ACATGTTAGCAGAAGAAAGGTGG + Intronic
1056368106 9:85926256-85926278 GTTTATAAGCAGAAGAATGTAGG + Intergenic
1057418865 9:94891826-94891848 AAATAATAACAGAAGAAGGTTGG - Intronic
1058656528 9:107226980-107227002 ACTTATGTGCAGAAGGAGGATGG + Intergenic
1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG + Intergenic
1060060778 9:120457461-120457483 GCTTATTATCAGAAGTAGTTAGG - Intronic
1060226747 9:121796295-121796317 TCTTATTAACATAAGAAGGCAGG + Intergenic
1061705134 9:132447225-132447247 ACTAATGAGCAGAAGAAACTTGG + Intronic
1203426342 Un_GL000195v1:42901-42923 ACTTTTTAGCAGAATAAACTAGG - Intergenic
1185480917 X:445648-445670 AGTTATGAGCAGAAAAAGTTTGG + Intergenic
1186829373 X:13375605-13375627 GCTTAATAGAAAAAGAAGGTGGG + Intergenic
1187415182 X:19087021-19087043 AGTTATATGCAGGAGAAGGTTGG + Intronic
1188283711 X:28302282-28302304 ACTTATAAGTAGTAGAAGGTAGG - Intergenic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1189224338 X:39399982-39400004 ACATAGTAGCAGAAACAGGTTGG - Intergenic
1189737230 X:44084051-44084073 ACTTACTAGCTGAAGAACCTTGG - Intergenic
1191111222 X:56804273-56804295 CCCTTCTAGCAGAAGAAGGTCGG + Intergenic
1191714113 X:64182462-64182484 ACTTATTAGCAGATTTAAGTGGG + Intergenic
1191769500 X:64740129-64740151 AGTTATTTGCAGAAGAAGGCAGG + Intergenic
1192038754 X:67594628-67594650 GCTTATTAGCAGTAGTAGGTAGG - Intronic
1192282040 X:69697899-69697921 AGTTATTAGCAGAAGAGAGTGGG - Intronic
1193276930 X:79600466-79600488 AATTATTAGAAGAAGAAAGAAGG - Intergenic
1194554966 X:95346058-95346080 ACATATTAGGAGATGAGGGTGGG - Intergenic
1196211530 X:113001037-113001059 CCTTGTTAGGAGTAGAAGGTAGG - Intergenic
1197097464 X:122612806-122612828 AGTTATCTGCAGAAGATGGTAGG - Intergenic
1197947149 X:131851756-131851778 ACTTATTAGCAGAAGAGGGTGGG - Intergenic
1198605294 X:138330919-138330941 ACTTATTGGCAGGAAGAGGTTGG - Intergenic
1198865246 X:141115639-141115661 ATTTATTAAAAGAAGAATGTTGG - Intergenic
1199024376 X:142919687-142919709 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1200967692 Y:9113670-9113692 ACTTATAAGTATTAGAAGGTTGG - Intergenic
1201552501 Y:15233337-15233359 ACTTTTTATGAGAAGAAGTTAGG + Intergenic