ID: 1043862719

View in Genome Browser
Species Human (GRCh38)
Location 8:85339380-85339402
Sequence TCTTACTTGGACATGGTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 5, 3: 41, 4: 265}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043862719_1043862722 30 Left 1043862719 8:85339380-85339402 CCATAAACCATGTCCAAGTAAGA 0: 1
1: 0
2: 5
3: 41
4: 265
Right 1043862722 8:85339433-85339455 GTTTTAACTACTTTACTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043862719 Original CRISPR TCTTACTTGGACATGGTTTA TGG (reversed) Intronic
905086213 1:35379884-35379906 TCTTACATTGACGTGGTTTGTGG + Intronic
905144161 1:35874115-35874137 TCTTATTTGGCCATGGTTCATGG - Intronic
906130977 1:43455725-43455747 TTTTCCTTGGACATGCCTTAGGG + Intergenic
907199481 1:52714171-52714193 TTTTAGTTTGACAAGGTTTAGGG + Intergenic
908975429 1:69891378-69891400 TCTTATATGGGCATGGTTCATGG + Intronic
909186983 1:72499930-72499952 TCTTATTGGGACAAGATTTAAGG + Intergenic
909735581 1:78957081-78957103 TCTTATATGGGCATGGTTCATGG - Intronic
911409115 1:97479467-97479489 TCTTATATGGGCATGGTTTGTGG + Intronic
912131776 1:106611869-106611891 TCTTATATGGACATGGTTCATGG + Intergenic
913075106 1:115335686-115335708 TCTTACTTGGAAAAGGTAAATGG + Intronic
913127034 1:115801150-115801172 TCTTATATGGGTATGGTTTATGG + Intergenic
915892686 1:159785806-159785828 TCATTCTGGGAAATGGTTTATGG - Intergenic
916286526 1:163111182-163111204 TCTCACTTGGCCATTGATTAGGG + Intronic
917353277 1:174100698-174100720 TCTTACATAGTCATGGTTTGTGG + Intergenic
917552327 1:176045901-176045923 TCTTTGTTGGACATGGTTGTTGG - Intronic
918606169 1:186428871-186428893 TCTTATATGGGCATGGTTCATGG + Intergenic
918720012 1:187840769-187840791 TCTTATCTTGACATGGTGTAAGG - Intergenic
918727393 1:187942972-187942994 TCATCCTTGGGCATGTTTTAGGG - Intergenic
919093908 1:193006725-193006747 TCTTACATGGGCATGGTTCATGG + Intergenic
919204081 1:194397640-194397662 TGTTATCTGGACATGGTTTGTGG + Intergenic
919487887 1:198166688-198166710 TTTTATTTGGACATGATTCATGG + Intronic
922624187 1:227021055-227021077 TCTTATATGGGCATGGTTTGTGG + Intronic
922903145 1:229153912-229153934 TCTTATATGGACATGGTTTGCGG + Intergenic
1063129275 10:3163554-3163576 TCTTACTTGGACATTGATTTTGG - Intronic
1063712064 10:8489109-8489131 TCTTCCCTGGACTTGGTTAAAGG + Intergenic
1063984937 10:11492208-11492230 TCTTACTTGGAAATTGTTTAAGG + Intronic
1064842030 10:19603842-19603864 TCTTATATGGGCATGGTTCATGG - Intronic
1065752513 10:28899987-28900009 TCATAATTGTACATTGTTTATGG + Intergenic
1070508806 10:77140853-77140875 GCTCCTTTGGACATGGTTTAGGG + Intronic
1070891800 10:79946699-79946721 TGCTTCATGGACATGGTTTAGGG + Intronic
1070984359 10:80675400-80675422 TCTTATATGGACATGGCTCATGG - Intergenic
1072474023 10:95741356-95741378 TCTTATATGGGCATGGTTCATGG + Intronic
1073781054 10:106838926-106838948 TCTTACATGGGCATGGTTCAGGG - Intronic
1076216578 10:128698369-128698391 TATTTCTTTTACATGGTTTACGG + Intergenic
1079379223 11:19922398-19922420 TCTTCCTTGAGCATGGTTTAGGG + Intronic
1080140304 11:28910390-28910412 TCTTAGTTAGACATGTTTGATGG - Intergenic
1080359133 11:31492819-31492841 TCTTACATGGGCACGGTTTCTGG + Intronic
1080848020 11:36043406-36043428 TCTTACTTGCAAATTGTTAAAGG - Intronic
1084369222 11:68727932-68727954 TCTTACATGGACATGGCTCGTGG - Intronic
1086999283 11:93397297-93397319 TCTTCTTTGGGCATGGTTAATGG + Intronic
1087657816 11:100946677-100946699 TCTTATGTGGACATGGTTAATGG + Intronic
1087671201 11:101109046-101109068 TCTTACATGGGCAAGGTTTGTGG - Intronic
1087913961 11:103786474-103786496 TCTTACATGGGCATGGTTTATGG + Intergenic
1088389492 11:109298444-109298466 TCTTACATGGGCATGGTTGGTGG + Intergenic
1088662050 11:112057111-112057133 TCTTATATGGGCATGGTTCATGG - Intronic
1088924175 11:114284032-114284054 ACTTACTGGGACCTGATTTAGGG - Intronic
1091427105 12:400665-400687 TCTTATATGGGCATGGTTCATGG + Intronic
1091821664 12:3480050-3480072 TCTTCCATGGACATGGATAATGG + Intronic
1093699850 12:22207045-22207067 TCTTACTTGAACCTGATTGATGG - Intronic
1093920646 12:24855960-24855982 TCTGATTTGCACATTGTTTAAGG - Intronic
1095175429 12:39086494-39086516 TCCTACTTGATCATGGTTAATGG + Intergenic
1099068016 12:78007802-78007824 TCTCACTTTTACATCGTTTACGG + Intronic
1099498650 12:83383580-83383602 ACTTAATTGGAGAAGGTTTAGGG + Intergenic
1099937933 12:89150414-89150436 TCTTACGTGGGCATGGTTTGTGG - Intergenic
1100176575 12:92037644-92037666 TCTTACTTAGAGATAGTATAAGG - Intronic
1100723488 12:97384156-97384178 TCTTGTATGGACATGGTTCATGG + Intergenic
1101515598 12:105432179-105432201 TCTGACTTTGGCATGGGTTATGG + Intergenic
1102297606 12:111749033-111749055 TCTTACTGGGACATGGTTAAAGG - Intronic
1104534068 12:129601742-129601764 TCTTACATGGGCATGGTTCATGG + Intronic
1106352847 13:28950693-28950715 TCTTATATGGGCATGGTTCATGG + Intronic
1106946646 13:34835213-34835235 TCTTATATGGGCATGGTTCATGG - Intergenic
1109131266 13:58589167-58589189 TCTTAAATGGGTATGGTTTATGG - Intergenic
1109815633 13:67579551-67579573 TCTTATATAGACATGGTTTGTGG + Intergenic
1109902979 13:68797718-68797740 TTTTACTGGGACATAGTTTATGG - Intergenic
1110022023 13:70486875-70486897 TCTTACATTGCCATGGTTTGTGG + Intergenic
1111276937 13:85962444-85962466 TCTTACTTGGACAAGGTGTATGG - Intergenic
1111857673 13:93660301-93660323 TCTTCCATGTACATGTTTTAAGG + Intronic
1113554956 13:111225710-111225732 TCTTACATGGGCATGGTTCATGG - Intronic
1115013124 14:28574505-28574527 TCTCATATGGACATGGTTTATGG + Intergenic
1115126232 14:29997822-29997844 TATTAATTGGTAATGGTTTAGGG + Intronic
1115154669 14:30324333-30324355 TCTTATTTGGATGTGGTTTGTGG - Intergenic
1115803036 14:37017404-37017426 TTTTACATGTACATGGTTCATGG + Intronic
1116072035 14:40059385-40059407 CATTACTTTGACATGCTTTAAGG + Intergenic
1117313045 14:54547634-54547656 TTCTACTTGGACATGGTGGAGGG - Intergenic
1117586130 14:57207506-57207528 TCCTACTTGGATATAGTTAATGG - Exonic
1117764498 14:59066894-59066916 TCTTATTTGGTCATGGTTGGTGG + Intergenic
1117887013 14:60374990-60375012 TCTTATATGGGCATGGTTCATGG - Intergenic
1118337536 14:64866784-64866806 TCCTACTTTGACATGCCTTAAGG + Intronic
1118506609 14:66420314-66420336 TCTTCCAGAGACATGGTTTATGG + Intergenic
1118587278 14:67366733-67366755 TCATACTTGTTCAGGGTTTATGG - Intronic
1119143354 14:72287941-72287963 TCCCACTTGGTCATGGTGTATGG + Intronic
1119179172 14:72593143-72593165 TCTTTCTTGGGCATGGTTGTGGG - Intergenic
1120318715 14:82931169-82931191 TCTTATTTGGGCATGGTTTCTGG + Intergenic
1121036358 14:90707240-90707262 TCTTAGGTGGGCATGGTTTGTGG - Intronic
1121766604 14:96492850-96492872 TCTTATATGGGCATGGTTTGTGG + Intergenic
1121997993 14:98620319-98620341 TCTTATATGGACATGGTTTATGG - Intergenic
1122993873 14:105252071-105252093 TCTTGTGTGGACAAGGTTTAAGG - Intronic
1123138960 14:106056458-106056480 TCTTACCTGGAGTTGGTTCAGGG - Intergenic
1124210631 15:27762225-27762247 TCTCACATGGACATGGAGTATGG - Intronic
1126885920 15:53149944-53149966 TCTTACATGAACATGATTTGTGG - Intergenic
1127523416 15:59767356-59767378 TCTTACTTTAACTTGCTTTAAGG - Intergenic
1128866360 15:71117605-71117627 TGTAATTTGGACATGGTTGAAGG - Intronic
1130290444 15:82594942-82594964 TCTTACATGGGAATGGTTTGTGG + Intronic
1131878860 15:96841000-96841022 TCTTATATGGGCATGGCTTATGG - Intergenic
1131910928 15:97200279-97200301 TGTAACTTGGACATGCTTTCTGG + Intergenic
1132475414 16:133974-133996 TCTTATGTGGACATGGTTCTTGG + Intronic
1134272994 16:12750528-12750550 CCTTAAATGGACATGGTTTGTGG + Intronic
1136025586 16:27466388-27466410 TCTTATGTGGGCATGGTTTGTGG - Intronic
1140310564 16:73844320-73844342 TGGTACTTGGACTTGGTTGAAGG + Intergenic
1144616954 17:16785156-16785178 TCTTACGTGAACATAGTTTGAGG + Intronic
1145060866 17:19732605-19732627 TCTTTCTATGACATGGATTAAGG - Intergenic
1145378656 17:22375104-22375126 TCTTGCTTTGATAAGGTTTAAGG - Intergenic
1146481663 17:33209917-33209939 CCCTATTTGGACATAGTTTATGG - Intronic
1148696215 17:49560600-49560622 TCTTATATGGGCATGGTTTGTGG - Intergenic
1150916566 17:69443627-69443649 TCTTACTAGGGCAAGGATTAGGG - Intronic
1155266176 18:24096021-24096043 TCTTATGTGGGCATGGTTTGTGG + Intronic
1155975377 18:32123105-32123127 TCAAACTAGGACATGGTATAAGG - Intronic
1156128310 18:33935493-33935515 TCTTAATTTGGCATGGTTCACGG + Intronic
1159514503 18:69440200-69440222 TCTTATATGGGCATGGTTTATGG + Intronic
1159560518 18:69987816-69987838 TCTCACTTGTTCATGGTGTATGG - Intergenic
1159561196 18:69996758-69996780 TCTTACTTGTACATTCTTTTGGG - Intergenic
1159695119 18:71547317-71547339 TCTTACATGGGCGTGGTTTGTGG + Intergenic
1160117408 18:76093661-76093683 TCTTATATGGGCATGGTTTGTGG + Intergenic
1160595098 18:79967850-79967872 CCTTGCTTGGACATGGATTTGGG - Intronic
1162243211 19:9375185-9375207 TCTCACTTGATCATGGTGTATGG + Intronic
1163135318 19:15306778-15306800 TCTTAGATGGACATGGTTTGTGG + Intronic
1166392181 19:42414817-42414839 TCTTACGTGGACATGGTTGGTGG - Intronic
1166422207 19:42646279-42646301 ACTTACTAGGTTATGGTTTATGG - Intronic
925060110 2:884565-884587 CCTTACTTTGAGATGGTTTTTGG + Intergenic
925360084 2:3272603-3272625 TCTTACATGGGCATGGTTCGTGG + Intronic
927731323 2:25474913-25474935 TCTTATGTGGGCATGGTTTGTGG - Intronic
928792075 2:34969494-34969516 TCTTATATGGGCATGGTTTGTGG + Intergenic
929837583 2:45420578-45420600 TCTTATTTGTACATGATATATGG - Intronic
930831332 2:55746724-55746746 TCTTACATGGGCATGATTTATGG - Intergenic
930967485 2:57347798-57347820 TTTTACTTGAACATGTTTTTTGG - Intergenic
932857398 2:75250688-75250710 TCTTACATTAACATGGTTCATGG + Intergenic
933721633 2:85401045-85401067 TCTCACTTGGAATGGGTTTACGG + Intronic
935746679 2:106194845-106194867 TTTTACTTCGGCAAGGTTTAGGG - Intergenic
936409544 2:112244751-112244773 TCTTATGTGGGCATGGTTCATGG - Intronic
936726564 2:115324987-115325009 TCTTATGTGGTCATGGTTCATGG + Intronic
937984677 2:127633162-127633184 TGTTTCTGGCACATGGTTTAGGG + Intronic
938365921 2:130734093-130734115 TCTTACTTAGATTTGCTTTATGG - Intergenic
938686052 2:133738994-133739016 TCTTATTTAGACATGAATTATGG - Intergenic
940018381 2:149130723-149130745 TCTTTCTTGTACCTGGTTTGTGG + Intronic
941433877 2:165444329-165444351 TCTTCCATGGGCATGGTTTGTGG - Intergenic
943616568 2:190099451-190099473 TCTTATATGGACACGGTTCAAGG + Intronic
943671825 2:190670928-190670950 TATTACTAGCACATGGGTTATGG + Intronic
943695112 2:190918933-190918955 TCTTATATGGACATGGCTTGTGG + Intronic
943695236 2:190921681-190921703 ACTTAATTTGAAATGGTTTAGGG - Intronic
943911783 2:193578231-193578253 TCCTACTTGGCCATGATGTATGG - Intergenic
948107134 2:235423611-235423633 TCTTATATGGGCATGGTTCATGG - Intergenic
948175460 2:235939338-235939360 TCCTGCTTGGACATGGGGTAGGG + Intronic
1169313922 20:4572177-4572199 TCTTACTTGGGATTGGTTCAAGG - Intergenic
1169972374 20:11282219-11282241 ACTTTCTTGGAAATGGATTAAGG + Intergenic
1174156735 20:48520696-48520718 TCTTACCTGTAGCTGGTTTATGG - Intergenic
1174652551 20:52140062-52140084 TCTTATATGGACATGGTTCATGG - Intronic
1174692545 20:52521973-52521995 CCTTATATGGACATGGTTTGTGG + Intergenic
1175004638 20:55669307-55669329 TATTAATTGTACAGGGTTTAAGG + Intergenic
1178106575 21:29325812-29325834 TCTTAATTGCACATGAATTATGG - Intronic
1178177095 21:30114989-30115011 TCTTATATGGGCATGGTTTGTGG + Intergenic
1178301430 21:31456620-31456642 TTTTACTTGGAAATGTTTTATGG + Intronic
1185084321 22:48730716-48730738 TCTTACACGGGCATGGTTTGTGG - Intronic
949626410 3:5871737-5871759 TCTTACATGGGCACGGTTTGTGG - Intergenic
951422178 3:22499810-22499832 TCTTATATGGGCATGGTTTATGG - Intergenic
952806039 3:37353121-37353143 TCTTATATGGGCATGGTTTGTGG + Intronic
955144803 3:56306516-56306538 TCTCACTTAGACAAGGTTCAAGG + Intronic
955290336 3:57686690-57686712 TCTTATATGGGCATGGTTTGTGG - Intronic
956406827 3:68936640-68936662 TCTTACGTGGACATGTTGCATGG - Intergenic
956491227 3:69774295-69774317 TCTTATTAGAAGATGGTTTAGGG + Intronic
957581265 3:82076458-82076480 TCAAACTTTGACATGATTTAGGG + Intergenic
957884766 3:86271959-86271981 TCTTTCTTGGAAATTGTTTTGGG - Intergenic
958510919 3:95047792-95047814 TCTAAATTGGAAATGGTTTTGGG + Intergenic
958698758 3:97561010-97561032 TCTTACATGGGCATTGTTCATGG - Intronic
959031241 3:101301150-101301172 TCTTACATGGATATTGTTCATGG + Intronic
959923921 3:111900564-111900586 TCTTATATGGGCATGGTTTGTGG + Intronic
961473604 3:127133860-127133882 TTTTATCTGGACATGGTTGAAGG - Intergenic
962461396 3:135616842-135616864 TCTTATGTGGGCATGGTTCATGG + Intergenic
963697051 3:148575325-148575347 TTCTACTAGGACATGCTTTAAGG - Intergenic
963773265 3:149411246-149411268 TCTTATATGGGCATGGTTTGTGG + Intergenic
964813563 3:160692476-160692498 TCTTATATGGACAGGGTTCAAGG - Intergenic
964930176 3:162009934-162009956 TCTTATATGGACATGGTTTGTGG + Intergenic
966858151 3:184210551-184210573 ACTTACTTGTAAATGGTTCATGG + Intronic
967412259 3:189178804-189178826 TTTTACTTAGCCATGGTTTAAGG + Intronic
967438611 3:189480095-189480117 ACTTTCTTGACCATGGTTTAGGG + Intergenic
967491840 3:190101057-190101079 TCTTATATGGGCATGGTTTGTGG - Intronic
970971844 4:21993542-21993564 TCTCACTTAGTCATGGTGTATGG - Intergenic
976139814 4:81979546-81979568 ACTTACTTGGATATGCTTTTGGG - Intronic
976885359 4:89976769-89976791 TCTTATATGGGCATGGTTAATGG + Intergenic
977114422 4:93004982-93005004 TCTTACTTCTACATGATCTAGGG + Intronic
977539320 4:98297583-98297605 TCATACATGGGCATGGTTCACGG - Intronic
977748075 4:100575434-100575456 TGTTCCTTGAACACGGTTTATGG + Intronic
977981271 4:103325314-103325336 TCTTATATGGGCATGGTTTGTGG + Intergenic
978102852 4:104863840-104863862 CCTTATTTGGCCATGGTTCATGG + Intergenic
978473548 4:109098426-109098448 TCTTACATCTACATGGATTATGG - Intronic
979374358 4:119928060-119928082 TCTTATATGGGCATGGTTCATGG - Intergenic
979619323 4:122780803-122780825 TCTTATATGGACATGGTTCATGG + Intergenic
979648626 4:123104289-123104311 TCTTACATGGGTGTGGTTTATGG - Intronic
979659088 4:123231906-123231928 TCTTATATGGGCATGGTTTGTGG + Intronic
981200635 4:141975389-141975411 TCTTATATGGACATAGTTTGTGG - Intergenic
981511114 4:145559821-145559843 TTTTCCTTGGTCATAGTTTAGGG - Intergenic
981764578 4:148233763-148233785 TCTTACGTGGTCATGGTTTGTGG + Intronic
982036182 4:151348396-151348418 TCTTATGTGGGCATGGTTTGTGG - Intergenic
982344650 4:154344122-154344144 TCTTTCATGGCCATGGTTTGTGG + Intronic
983300878 4:165923983-165924005 TCTTATATGGGCATGGTTCATGG - Intronic
983764421 4:171459958-171459980 TCTTATATGGACCTGGTTAATGG + Intergenic
984795304 4:183654750-183654772 ACATACTTGGAGATGGTGTAAGG + Intronic
986682200 5:10244173-10244195 TCTTATTTGGGCATGGCTTGTGG + Intronic
988174954 5:27710875-27710897 TCTTATATGGTCATGGTTCATGG - Intergenic
988857407 5:35242157-35242179 TTTCACTTGGTCATGGTGTATGG + Intergenic
989762047 5:45027569-45027591 TCTTACGTGGGCATGCTTCATGG - Intergenic
990697496 5:58436960-58436982 TCTTATATGGACGTGGTTCATGG + Intergenic
990797375 5:59559424-59559446 TATTACATGGACTTTGTTTAAGG + Intronic
990832646 5:59976903-59976925 TCTTACATGGGCATGGTTTGTGG - Intronic
991171618 5:63633144-63633166 TCTTACATGGATATGGTTCATGG + Intergenic
991182244 5:63766266-63766288 TCTTTCTCAGACATGGTATAAGG + Intergenic
991183459 5:63781245-63781267 TCTTACTTGACCCTGGTTCAGGG - Intergenic
993012246 5:82496347-82496369 TTTTACTGGGACAAGGTTTCTGG - Intergenic
993958950 5:94272780-94272802 TGTTTCTTGCACATGGCTTAGGG + Intronic
994466992 5:100148812-100148834 TCTTATGTGGGCATGGTTTGTGG + Intergenic
995426157 5:112025795-112025817 TCTTATATGGGCATGGTTTGTGG - Intergenic
995431234 5:112080228-112080250 TCTTATATGGGCATGGTTCATGG - Intergenic
995505817 5:112859890-112859912 TCTTATCTGGGCATGGTTCATGG + Intronic
995678513 5:114690816-114690838 TCTCACATGGGTATGGTTTATGG + Intergenic
995929840 5:117426878-117426900 TTTTCTTTGGACATAGTTTATGG + Intergenic
996512521 5:124332880-124332902 TCTTATATGGGCATGGTTTGTGG + Intergenic
996660400 5:125996153-125996175 TGTTATAAGGACATGGTTTATGG - Intergenic
1000847212 5:166296756-166296778 TCTATCTTGGCCATGCTTTAAGG - Intergenic
1001891363 5:175341931-175341953 TCTAATTTGGACACGTTTTATGG - Intergenic
1002856835 6:1045379-1045401 TCTGACCTGGACATGGTCAAGGG + Intergenic
1003822875 6:9919683-9919705 CCTTATATGGGCATGGTTTATGG - Intronic
1009590015 6:65656080-65656102 TCTTATATGGGCATGGTTTGTGG - Intronic
1009963380 6:70551805-70551827 TCTTACATAGGCATGGTTCATGG + Intronic
1012702816 6:102483778-102483800 TCTTACTTGGAAAATATTTATGG - Intergenic
1013739795 6:113268897-113268919 TCTTATATGGGCATGGTTTGTGG - Intergenic
1015071202 6:129095588-129095610 TCCTAATGGGACATGGGTTATGG + Intronic
1015350343 6:132210515-132210537 TCTTTCCTGGGCATGGATTATGG - Intergenic
1015559677 6:134501318-134501340 TCTTACATGGAAATGGATGAAGG - Intergenic
1016616948 6:146061141-146061163 TCTTATATGGGCATGGTTCATGG + Intronic
1016794053 6:148098906-148098928 TCTTATATGGGCATGGTTTGTGG - Intergenic
1016903262 6:149123107-149123129 TCTTATCAGGGCATGGTTTATGG - Intergenic
1017314359 6:153013296-153013318 TCTTATATGGGCATGGTTCATGG - Intronic
1018250592 6:161866163-161866185 TCTTATTTGGGCATGGTTTTTGG + Intronic
1019159495 6:170059606-170059628 TCTTACATGGATGTGGTTTGTGG - Intergenic
1020409229 7:7872451-7872473 TCTTACATGGGCATGGTTCGTGG + Intronic
1020833326 7:13118369-13118391 TCTAACATGGCCATGGTTCATGG - Intergenic
1020944540 7:14585862-14585884 TCTTACATGGGCGTGGTTCATGG - Intronic
1022365748 7:29714312-29714334 TCTTACTTGGGAATGGCTCAGGG - Intergenic
1022790060 7:33679271-33679293 TCTTTCTTGCACTTGATTTATGG + Intergenic
1024336713 7:48215350-48215372 TCTTATATGGGCATGGTTTGTGG + Intronic
1027400431 7:77800193-77800215 CCTAACTTGGATATGGTGTATGG + Intronic
1027908871 7:84221724-84221746 TCTTACATAGGCATAGTTTATGG + Intronic
1028578230 7:92377348-92377370 TCTTATATGGGCATGGTTCATGG + Intronic
1030505170 7:110412293-110412315 TCTTATATGGTCATAGTTTATGG + Intergenic
1030698305 7:112610576-112610598 TCTTATGTGGGCATGGTTCATGG - Intergenic
1031570093 7:123348548-123348570 TCTTACTAGGAAATGATTTTTGG + Intergenic
1032712988 7:134478436-134478458 TCTTATATGGACACGGTTCATGG + Intergenic
1033022708 7:137742569-137742591 TCTGACTTGGAAATGACTTACGG - Intronic
1034636921 7:152575044-152575066 TCCTGCTTGAACAGGGTTTATGG - Intergenic
1034747123 7:153532602-153532624 TCTTACTGGGAAATGGTGGATGG + Intergenic
1037210943 8:16386990-16387012 TCTGACTTGGTCATAGTGTATGG + Intronic
1037417133 8:18664003-18664025 TCTTATGTGGAGATGGTTAATGG - Intronic
1038465100 8:27754782-27754804 TTTTGATTGGAAATGGTTTAAGG + Intronic
1039903563 8:41769696-41769718 TCTTATGTGGCCATGGTTTCAGG - Intronic
1040919291 8:52599050-52599072 TCTTACTTGTGCATGTGTTAAGG - Intergenic
1041277886 8:56181899-56181921 TCTTAATTGTACATTTTTTAAGG - Intronic
1042686755 8:71450480-71450502 TCTTATATGGGCATGGTTTGTGG + Intronic
1043862719 8:85339380-85339402 TCTTACTTGGACATGGTTTATGG - Intronic
1044289506 8:90451265-90451287 TCTTACGTGAGCATGGTTTTTGG + Intergenic
1045449703 8:102310146-102310168 TCTGATTTGGGCATGGTTGATGG - Intronic
1045552306 8:103183455-103183477 TCTTACCTGTACATGGTGTGTGG - Intronic
1046517381 8:115280857-115280879 TCCCAGTTGGACATGGTGTATGG - Intergenic
1047832942 8:128656182-128656204 ACATACTTGGACTTGGTCTATGG + Intergenic
1048824349 8:138409326-138409348 TCTTACATGGGCATGCTTCATGG + Intronic
1048902460 8:139051866-139051888 TCTTATGTGAACATGGTTTGTGG - Intergenic
1048943271 8:139421315-139421337 TCTTACATGGCCGTGGTTCATGG + Intergenic
1050565105 9:6874025-6874047 TCTTATGTGGGCATGGTTTGTGG + Intronic
1051085039 9:13338517-13338539 TCTTACATGGGCATGGTTCATGG + Intergenic
1051721608 9:20042886-20042908 TCTTACATGGGCATGGCTTGTGG - Intergenic
1051767777 9:20543392-20543414 TCTTACATGGGTATGGCTTATGG + Intronic
1052569356 9:30200264-30200286 TCCTAATGGGACATGGTATATGG + Intergenic
1052613512 9:30807953-30807975 TATTACTTGGACATGTCATATGG - Intergenic
1055839480 9:80484992-80485014 TAATACATGAACATGGTTTATGG + Intergenic
1055873983 9:80920614-80920636 TCTTACATGGGTATGGTTTGCGG + Intergenic
1056274276 9:84977952-84977974 TCTTACATGGATATAGTTTGTGG - Intronic
1057015760 9:91649726-91649748 TCCCACTTGGTCATGGTATAGGG - Intronic
1057823714 9:98355157-98355179 TCTTATCTGGGCATGGTTTGTGG + Intronic
1058641723 9:107093593-107093615 TCTTACATGGGTGTGGTTTATGG + Intergenic
1059158097 9:112007613-112007635 TCTTATATGGGCATGGTTTGTGG - Intergenic
1060460424 9:123848427-123848449 TCTTATATGGGCATGGTTTATGG - Intronic
1060842262 9:126803187-126803209 TCTTACTTGGACTTTATTTCTGG - Intergenic
1061155837 9:128860887-128860909 TCTTATATGGGCATGGTTTGTGG + Intronic
1061544489 9:131296622-131296644 TCTTCCTGGGAGAGGGTTTAAGG - Intronic
1062107702 9:134764797-134764819 TATTACTTGGACATGTGTTAAGG - Intronic
1187800397 X:23055959-23055981 TCTTATATGGGCATGGTTCATGG - Intergenic
1189869037 X:45362898-45362920 TCTTATTTTGGCAAGGTTTATGG - Intergenic
1191803813 X:65111748-65111770 TCTTATATGGGCATGGTTTGTGG - Intergenic
1192189592 X:68982878-68982900 GCTTACTTGGACATGTTATTTGG + Intergenic
1193424061 X:81319353-81319375 TCCTACTTTGATATGGTTCAAGG - Intergenic
1193577515 X:83219565-83219587 TTTTGCTTGGTCATAGTTTATGG - Intergenic
1193833359 X:86314009-86314031 TTTTACATGGGCATGGTTTGTGG - Intronic
1193906000 X:87244898-87244920 TCTTATTTGGGGGTGGTTTAGGG - Intergenic
1194913693 X:99678828-99678850 TCATATTTTGACATGGTGTATGG - Intergenic
1195162235 X:102182019-102182041 TCTTCCTTGGGCAAGGGTTAGGG + Intergenic
1195634696 X:107100781-107100803 TCTTTCTTGTACATGTTTTCTGG - Intronic
1195987931 X:110651438-110651460 TCTTATATGGGCATGGTTTGTGG + Intergenic
1196573780 X:117294555-117294577 TTTTCCTTGGAAATAGTTTATGG - Intergenic
1198341805 X:135721453-135721475 TCTTACTTGGTTATGGTTAAAGG + Intronic
1198346189 X:135761909-135761931 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198348094 X:135779194-135779216 TCTTACTTGGTTATGGTTAAAGG - Intergenic
1198350000 X:135796456-135796478 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198351912 X:135813729-135813751 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198353814 X:135830998-135831020 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198355728 X:135848247-135848269 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198357639 X:135865526-135865548 TCTTACTTGGTTATGGTTAAAGG - Intergenic
1198359547 X:135882809-135882831 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198621366 X:138514343-138514365 TCTTATATGAACATGGTTTTTGG + Intergenic
1199090659 X:143688139-143688161 TCTTATATGGCCATGGTTTGTGG + Intergenic
1199667393 X:150109408-150109430 ATTTACTTACACATGGTTTATGG + Intergenic
1200391759 X:155952656-155952678 TCTGACTTGGGCTTGGTTTTAGG + Intergenic
1200801968 Y:7395083-7395105 TATTAATTTGACATGGTTTGGGG - Intergenic
1200959554 Y:8984387-8984409 TTTTACTAGGGCATGCTTTAAGG - Intergenic
1201671792 Y:16530215-16530237 TCTAACTTGGACATCGTTTTTGG - Intergenic