ID: 1043864230

View in Genome Browser
Species Human (GRCh38)
Location 8:85357520-85357542
Sequence CTGCTATCATTGTTCATGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043864228_1043864230 18 Left 1043864228 8:85357479-85357501 CCAGGTGTCTAGTTACCTGGTAC 0: 1
1: 0
2: 1
3: 8
4: 50
Right 1043864230 8:85357520-85357542 CTGCTATCATTGTTCATGAGAGG No data
1043864229_1043864230 3 Left 1043864229 8:85357494-85357516 CCTGGTACTTACAGTATGATTGA 0: 1
1: 0
2: 0
3: 8
4: 224
Right 1043864230 8:85357520-85357542 CTGCTATCATTGTTCATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043864230 Original CRISPR CTGCTATCATTGTTCATGAG AGG Intronic
No off target data available for this crispr