ID: 1043865531

View in Genome Browser
Species Human (GRCh38)
Location 8:85370866-85370888
Sequence GATCCATTTAAACACAATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 236}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043865531_1043865532 14 Left 1043865531 8:85370866-85370888 CCATTATTGTGTTTAAATGGATC 0: 1
1: 0
2: 1
3: 23
4: 236
Right 1043865532 8:85370903-85370925 TTTACATTTGCATACTATTCTGG No data
1043865531_1043865533 25 Left 1043865531 8:85370866-85370888 CCATTATTGTGTTTAAATGGATC 0: 1
1: 0
2: 1
3: 23
4: 236
Right 1043865533 8:85370914-85370936 ATACTATTCTGGATACTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043865531 Original CRISPR GATCCATTTAAACACAATAA TGG (reversed) Intronic
901485943 1:9561735-9561757 GAGTCATTTAAACACAATTAAGG - Intronic
901890755 1:12261707-12261729 GATCCCTTAAAAAACAATTAGGG + Intronic
902126288 1:14214596-14214618 GAATTATCTAAACACAATAAAGG + Intergenic
903906343 1:26690054-26690076 AAGCCATTTAAAAACAATACGGG - Intergenic
910717346 1:90246720-90246742 GCTCCATTTAACTACAAGAAGGG - Intergenic
911137343 1:94455068-94455090 CAACCATTTAAACACAATACTGG - Intronic
915789171 1:158649072-158649094 AATACATTTATACACAATGAAGG + Intronic
915978015 1:160403146-160403168 GATCCATTAAAAAAAAAAAAAGG - Intronic
918152652 1:181811404-181811426 GCTTCATTAAAACACAATAATGG + Intergenic
920567083 1:206982735-206982757 GATGCATTTTAAATCAATAAAGG + Intergenic
923293879 1:232573891-232573913 GATCCTTTTAAACGCATTCAGGG + Intergenic
924523315 1:244824186-244824208 TATGCATTTAAAGAAAATAATGG + Intergenic
1063774748 10:9249957-9249979 GATCCAAATAAACAAAATCAGGG + Intergenic
1065249138 10:23792921-23792943 GCTCCATTTAAACATAACACTGG - Intronic
1065460394 10:25956618-25956640 GAATCATTTAAAAACCATAATGG - Intronic
1069349476 10:67508317-67508339 AATGTATTTCAACACAATAAAGG + Intronic
1070360416 10:75683131-75683153 GCTCCCTCTAAAAACAATAATGG + Intronic
1071166057 10:82808375-82808397 AATTCATTTAAATTCAATAAAGG + Intronic
1077682620 11:4257779-4257801 AATGCATCTCAACACAATAAAGG - Intergenic
1077687414 11:4308959-4308981 AATGCATCTCAACACAATAAAGG + Intergenic
1077692582 11:4360150-4360172 AATGCATCTCAACACAATAAAGG + Intergenic
1077713534 11:4558963-4558985 GATCCATTCTAACACAATTATGG + Intergenic
1077900755 11:6486264-6486286 GAACCATTTCAACAGAATGATGG - Intronic
1078045300 11:7908829-7908851 GATCAATTTTAAAACAATATAGG + Intergenic
1078690283 11:13573054-13573076 GATGCAATAAAAAACAATAAAGG + Intergenic
1079134145 11:17766763-17766785 GAGCCATTTAGACACAATCAGGG + Intronic
1079608134 11:22395659-22395681 GATCCATCTAAAAACAGAAATGG + Intergenic
1081956850 11:47100322-47100344 GATCAATCTAAACATATTAAGGG - Intronic
1082906655 11:58314931-58314953 GAACATTTTAAACCCAATAAAGG - Intergenic
1083759732 11:64809293-64809315 GAGGCAGTTAAACAAAATAATGG - Intronic
1085281981 11:75336935-75336957 GATCCAATGAAACAGAAAAAGGG + Intronic
1085549075 11:77350131-77350153 GATCCTTTAAAATAAAATAATGG + Intronic
1087084904 11:94207307-94207329 AATGCACTTCAACACAATAAAGG + Intergenic
1087332862 11:96804529-96804551 GATCTATGTAAATAAAATAAAGG - Intergenic
1087492517 11:98846182-98846204 CAACCATCTAAACAGAATAAAGG - Intergenic
1087502081 11:98970329-98970351 AATACATTTAAACACAGAAAAGG + Intergenic
1091162399 11:133436893-133436915 GATTCATTTATACACACTCATGG + Intronic
1093513618 12:19958488-19958510 ATTCCATTTAAATAAAATAATGG - Intergenic
1094128774 12:27052296-27052318 TGTCCATTTAAAAACAATACAGG + Intronic
1095552742 12:43462459-43462481 GATACACTTAGAAACAATAAAGG + Intronic
1097528123 12:60764310-60764332 GATGCAATAAAAAACAATAAAGG - Intergenic
1097748066 12:63321167-63321189 GATCCATTGAAACACATTTTGGG - Intergenic
1098654445 12:73010092-73010114 GATACAAATAAACTCAATAAGGG - Intergenic
1100238734 12:92687990-92688012 CATCCACTCAAACACAATCATGG + Intergenic
1100319769 12:93479672-93479694 GAACCATTTAAACACAATTATGG + Intronic
1100361492 12:93883880-93883902 GATTCATATAAAGACAATGAAGG + Intronic
1102826680 12:115952801-115952823 GCTGAATTTTAACACAATAATGG + Intergenic
1103110748 12:118276105-118276127 GATCCTTTTAAACACAGAAGTGG - Intronic
1106867119 13:33977361-33977383 GTTTTATTTAAAAACAATAAGGG + Intergenic
1107796428 13:44057027-44057049 GAGACATTTAATAACAATAAAGG + Intergenic
1109173520 13:59126163-59126185 TATCCATTTAAATAAAATAATGG + Intergenic
1109217321 13:59604397-59604419 GATGGATTGCAACACAATAATGG + Intergenic
1109820432 13:67645436-67645458 GTTCCATTTTAACATAAAAAGGG + Intergenic
1110240774 13:73264328-73264350 AACCCTTTTGAACACAATAATGG - Intergenic
1110679188 13:78288112-78288134 GATATATTTGAAAACAATAAGGG - Intergenic
1110748458 13:79083998-79084020 GAGTCATTCAAAAACAATAAAGG + Intergenic
1110954127 13:81532265-81532287 AATGCATTTAAACAATATAATGG - Intergenic
1113165329 13:107434197-107434219 TTTGCATTTTAACACAATAATGG - Intronic
1113302859 13:109041800-109041822 GATACATGTAGACACAATAAAGG + Intronic
1113817404 13:113183036-113183058 TATCCACTTAAATACAATCAGGG + Intronic
1114811593 14:25906747-25906769 GAGGGATTTAAACACAAGAATGG + Intergenic
1114827928 14:26104203-26104225 GATGTATTCAAACATAATAAGGG + Intergenic
1115460423 14:33653874-33653896 CATCTATTTCTACACAATAACGG - Intronic
1115940735 14:38607006-38607028 GATGTATCTCAACACAATAAAGG + Intergenic
1116082590 14:40194046-40194068 GATCTATCTCAACACAATAAAGG + Intergenic
1116115017 14:40636552-40636574 GATATATATAAACAGAATAAAGG + Intergenic
1116119292 14:40701330-40701352 GATATATTTAAAAATAATAAAGG + Intergenic
1116441524 14:44960597-44960619 GATTCATTTAAACACGAAAATGG + Intronic
1117399121 14:55342319-55342341 TATCCATTAACAGACAATAAAGG + Intronic
1117697141 14:58377199-58377221 TATCTCTTTAAACAGAATAAGGG + Intergenic
1119900087 14:78252042-78252064 GATCTATTTAAAAACAATACGGG + Intronic
1121734716 14:96210239-96210261 TATCCATTTAGACACAAAACGGG + Intronic
1123478383 15:20609297-20609319 GATAAATATAAAAACAATAATGG - Intergenic
1123639631 15:22391088-22391110 GATAAATATAAAAACAATAATGG + Intergenic
1125300413 15:38248977-38248999 GTTCCAGCTAAACACAAAAAAGG - Intergenic
1126207689 15:46063823-46063845 AATGCACCTAAACACAATAAAGG + Intergenic
1129347772 15:74934961-74934983 ACTCCATTTAAAAACAAAAAAGG + Intronic
1129802630 15:78427618-78427640 TATACATTTTAACACCATAAAGG + Intergenic
1130863488 15:87911511-87911533 GTTCCATTTTCACACAATAAGGG + Intronic
1131831113 15:96354934-96354956 TATCCTTTTAAACACCACAAAGG - Intergenic
1135530125 16:23245903-23245925 TTTCCATTTAAACACATTAATGG + Intergenic
1137046962 16:35674414-35674436 AATCCATTCAATCAAAATAAAGG - Intergenic
1140171785 16:72612295-72612317 GATCCCTTTAAAGAGAAAAAAGG + Intergenic
1143291219 17:5830710-5830732 GATTTATTTAAACACAAAATTGG + Intronic
1143905962 17:10209407-10209429 GAACCATTTCTACACAATAGAGG - Intergenic
1144408156 17:14973062-14973084 GAACAATGTAAACACAAGAAAGG - Intergenic
1148471636 17:47896940-47896962 GATCCAAGTAAAAACATTAAAGG - Intronic
1153419011 18:4883367-4883389 GATGCAATAAAAAACAATAAAGG - Intergenic
1156235591 18:35200947-35200969 GATCCAGTTATACAGTATAAAGG - Intergenic
1156243513 18:35275941-35275963 AATCCATATCAACAGAATAAAGG - Intronic
1157046063 18:44103189-44103211 GTTCCATGTAAAGACAATACTGG - Intergenic
1157860248 18:51134715-51134737 GATCAATATAAACATATTAATGG + Intergenic
1158242585 18:55393475-55393497 GATCCATTTGATCATCATAATGG - Intronic
1158380460 18:56924527-56924549 GTTTCACTTAAACACAGTAAAGG + Intronic
1159086447 18:63797727-63797749 GATTCATTGAAAGACAAGAAAGG - Intronic
1159415450 18:68141747-68141769 AATACATTTAAACAAAAAAATGG - Intergenic
1162633642 19:11948560-11948582 CATCCATTAGAACACAAGAAAGG + Exonic
1163174866 19:15557153-15557175 GATCCCTGGAAACACAATTAGGG - Intergenic
1164391530 19:27826707-27826729 GATCAATACAAACACATTAATGG - Intergenic
1164697604 19:30258136-30258158 CTTCCATTTAAACACAAAATGGG - Intronic
1165095730 19:33408848-33408870 GATCAATTTCAATACAACAATGG + Intronic
927257324 2:21050882-21050904 GAGTCATTTAAAAAAAATAATGG + Intergenic
933376216 2:81482514-81482536 GATGTATCTCAACACAATAAAGG - Intergenic
935318014 2:101856763-101856785 GATCAATTCAAAGACAAGAAAGG - Intronic
936146487 2:109984009-109984031 GATCCATTTTATAAAAATAAAGG - Intergenic
936198203 2:110387470-110387492 GATCCATTTTATAAAAATAAAGG + Intergenic
936988628 2:118337699-118337721 AATGTATTTCAACACAATAAAGG - Intergenic
937544119 2:122994520-122994542 TATACCTTTAAACACATTAAAGG + Intergenic
937802260 2:126094033-126094055 GATACATTTTAACAGAATGAAGG + Intergenic
939054143 2:137342659-137342681 AATGCATCTACACACAATAAAGG - Intronic
939483704 2:142781307-142781329 GATACATTTAACAACAAGAATGG + Intergenic
940740252 2:157499199-157499221 GCACCATTTAATCATAATAATGG - Intergenic
942460747 2:176166678-176166700 CATACATTTAAGAACAATAATGG + Intronic
943035711 2:182743145-182743167 GATCCATTAAGAAACAAGAAGGG - Intronic
943496823 2:188630702-188630724 TATACATTGAAACACTATAATGG - Intergenic
943883992 2:193187812-193187834 GATCCGTTTAAAAAAAAAAAAGG - Intergenic
944630993 2:201624191-201624213 AATACATTTAAAAACAAAAATGG + Exonic
944673452 2:202015552-202015574 CATGCATTTAGACACAATTAGGG + Intergenic
944745965 2:202657017-202657039 CATCCCTTTAAATACAACAAAGG - Intronic
945031505 2:205668690-205668712 GAACATTTTCAACACAATAAAGG - Intergenic
945167952 2:206966343-206966365 GTTCCATTTAAAAAAAAAAATGG + Intronic
948150677 2:235742049-235742071 GACCCATTTAAACACTTCAAAGG + Intronic
1169836258 20:9882979-9883001 AATACACTTCAACACAATAAAGG - Intergenic
1170570964 20:17632380-17632402 GAGCCTTTAAAACACAATCATGG + Intronic
1172825541 20:37780690-37780712 CATCATTTTAAACACAAAAATGG - Intronic
1173179434 20:40793135-40793157 GAGCCATTTAATAGCAATAAAGG - Intergenic
1175477889 20:59289693-59289715 GTGGCTTTTAAACACAATAATGG + Intergenic
1178082953 21:29084294-29084316 GATTCTATTAAAAACAATAATGG + Intronic
1178884986 21:36478068-36478090 GATTTTTTTAAAAACAATAATGG + Intronic
1180625912 22:17193324-17193346 GTTTTATTTAAACACAAAAAGGG - Intronic
1182591784 22:31386620-31386642 GATCCAAATAAACACAATTAAGG - Intergenic
950049645 3:9977520-9977542 GACCTATTTAAACACAAGAGAGG + Intronic
951330640 3:21364376-21364398 AATGCATTTAAAATCAATAATGG - Intergenic
951386484 3:22049664-22049686 AATCTATTTCGACACAATAAAGG - Intronic
952000069 3:28774878-28774900 AATCCATTTCAAAACAATATGGG + Intergenic
952983920 3:38760690-38760712 GATCCATTGCCACACAGTAAGGG + Exonic
953127842 3:40109068-40109090 TTTCCTTTGAAACACAATAAAGG + Intronic
957595583 3:82261063-82261085 GATACATTTAAAAAGAAGAAAGG + Intergenic
957722081 3:84015120-84015142 AATGTATTTCAACACAATAAAGG + Intergenic
957793324 3:84967670-84967692 GATCCATTAAAATAAATTAATGG + Intronic
957998277 3:87718971-87718993 AATGCAGTTTAACACAATAATGG + Intergenic
958544972 3:95535308-95535330 GATGTTTTTAAACACAACAAGGG - Intergenic
960411106 3:117325790-117325812 TAACCATCTAAACTCAATAATGG - Intergenic
962645924 3:137440140-137440162 AATCCATTTCAACAAAATAAAGG - Intergenic
963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG + Exonic
964654785 3:159054301-159054323 AATCCACTTAAACAAAATACAGG - Intronic
966713939 3:182996926-182996948 GATTCAAATAAACACAATCAGGG - Intergenic
967771889 3:193342956-193342978 GACACATTTCAACACATTAAAGG + Intronic
969041753 4:4303201-4303223 GATGATTTTAAACAAAATAAGGG + Intronic
971450691 4:26798827-26798849 GATTCATATAAACACAAAGATGG + Intergenic
971617887 4:28816564-28816586 AAAACATTTCAACACAATAAAGG + Intergenic
973119800 4:46507821-46507843 GATGGATTTAAACCCCATAATGG - Intergenic
973927839 4:55757747-55757769 GATCCATTTATGCAAATTAAGGG - Intergenic
974003377 4:56532281-56532303 GATCCATTGTAAGAAAATAAGGG - Intronic
974498209 4:62661275-62661297 GATACATTCAAAGAAAATAAAGG + Intergenic
974710375 4:65585793-65585815 GAACAATTTACACAAAATAAAGG + Intronic
975655185 4:76634215-76634237 GAGGCACTTAAAAACAATAAAGG - Intronic
975898907 4:79126593-79126615 GATCCAAATAAATATAATAAAGG - Intergenic
976044903 4:80934077-80934099 AATGCACTTCAACACAATAAAGG - Intronic
977061514 4:92263587-92263609 GATCAATTTTTAAACAATAAAGG + Intergenic
978998234 4:115182408-115182430 GATCTAATGAAACACAAGAATGG + Intergenic
982444245 4:155471557-155471579 GATACCTTAAAACACAAAAATGG - Intergenic
983040337 4:162917447-162917469 GTTCCATTTAAACACATTGCTGG + Intergenic
983135522 4:164074736-164074758 GATCGATTTAAAACTAATAATGG - Intronic
983658514 4:170107956-170107978 TATCTATTTATGCACAATAAAGG - Intergenic
984380955 4:178992147-178992169 GATCTATTTAAAAACTATATAGG + Intergenic
984566251 4:181334432-181334454 GATTCATACATACACAATAAAGG - Intergenic
984598693 4:181701795-181701817 CATTTATTTATACACAATAAAGG + Intergenic
987446284 5:18023433-18023455 AAACCATTTAAACACATTAGAGG + Intergenic
989548550 5:42704205-42704227 AATGTATTTCAACACAATAAAGG - Intronic
989754090 5:44931340-44931362 AATACATCTCAACACAATAAAGG - Intergenic
991562364 5:67967252-67967274 CATCCATATATACACAATATTGG - Intergenic
991899861 5:71449648-71449670 GATCCATTTAAAATAATTAACGG - Intergenic
993303974 5:86251935-86251957 GAACCAAATAAATACAATAAAGG - Intergenic
993358043 5:86939201-86939223 GATGCAATTAAAAATAATAAAGG - Intergenic
993896013 5:93535822-93535844 AAGACACTTAAACACAATAAAGG + Intergenic
994059955 5:95463986-95464008 AATGCATTTAAAAACATTAATGG - Exonic
994122324 5:96129662-96129684 GATCCATTTAAAAATAATTTAGG + Intergenic
995756781 5:115513726-115513748 CATCCATTTAATCACAGTAATGG - Intergenic
996314650 5:122148296-122148318 GATACCTTTAGTCACAATAAGGG + Intronic
996973445 5:129401059-129401081 GATCCATTCAAATTCAAGAAAGG + Intergenic
997366766 5:133330710-133330732 TATCCATTTCAAGATAATAAAGG + Intronic
998650219 5:144110888-144110910 AATTTACTTAAACACAATAAAGG + Intergenic
998686050 5:144527296-144527318 GATATAATTCAACACAATAAAGG + Intergenic
998997403 5:147880662-147880684 GCTCCATGGAAACACAAGAAAGG - Intronic
999153420 5:149441724-149441746 AATCCATTTAAACTCAACCAAGG + Intergenic
1000450948 5:161386252-161386274 GTGCCATTAAATCACAATAAGGG - Intronic
1005006750 6:21294933-21294955 CATCCATTTCAGCACAATGAAGG - Intergenic
1005044960 6:21633154-21633176 AATACATTTATACTCAATAATGG - Intergenic
1005777879 6:29156642-29156664 GATCTATTAAAAAATAATAAAGG - Intergenic
1005984995 6:30866178-30866200 GTTCCAGTTCATCACAATAAAGG + Intergenic
1007965975 6:46004030-46004052 GAACCATTTTAACAGAATATGGG + Intronic
1008750089 6:54722420-54722442 GATTCATTTGAGCACAATATCGG + Intergenic
1009248590 6:61271636-61271658 GATACAATAAAAAACAATAAAGG + Intergenic
1010588674 6:77686429-77686451 GATACATTTAAAGACAAAAGGGG - Intergenic
1010660435 6:78564291-78564313 GTTCCATTTAAAAACAAGAAAGG - Intergenic
1012513908 6:100036459-100036481 GATTCATAAAAACACAAAAAAGG - Intergenic
1012575770 6:100795632-100795654 AATCCATTTAATGACATTAATGG + Intronic
1012706796 6:102541550-102541572 TATCCATTTAAAGATAATAAAGG + Intergenic
1013096447 6:106949802-106949824 GTACAATTTAAACATAATAAAGG + Intergenic
1013335562 6:109156473-109156495 AATCCATCTAAACAAAATATTGG - Intronic
1014007565 6:116437443-116437465 GATTCATTTTAACAAATTAAGGG + Exonic
1014122709 6:117744443-117744465 GATGTATTTTAACAAAATAAAGG + Intergenic
1014131778 6:117843273-117843295 AATGTATTTCAACACAATAAAGG + Intergenic
1014712600 6:124824843-124824865 CATCCATGCAAACACAGTAATGG - Exonic
1015521325 6:134134278-134134300 GATCCATTTATAAACAAAAAAGG + Intergenic
1015599337 6:134897124-134897146 CATCCATAAAAACCCAATAAGGG - Intergenic
1018967734 6:168501655-168501677 GGTCCACTAAAAAACAATAAAGG + Intronic
1019096284 6:169582632-169582654 GATTCATTTCTCCACAATAAAGG + Intronic
1019097818 6:169599610-169599632 GATGCAATAAAAAACAATAAAGG - Intronic
1019841440 7:3450144-3450166 GATCCAATTATACAGAATAACGG - Intronic
1020509928 7:9041951-9041973 AATCCATTGAAACAGAATATTGG - Intergenic
1020591972 7:10150835-10150857 GATACCTTTAAATAGAATAAAGG + Intergenic
1021415843 7:20383617-20383639 TATCCTTTTAAATACAATTATGG - Intronic
1023224958 7:37959682-37959704 CTTCCATTTAAGCACAAAAAGGG + Intronic
1024839030 7:53562521-53562543 TATCCATTTAAAAACATTATTGG - Intergenic
1027142051 7:75665275-75665297 GAACAATTAAAACAAAATAAAGG + Intronic
1028244759 7:88463402-88463424 GATGCATTTAAACACCTTTATGG + Intergenic
1028310277 7:89323749-89323771 TACACATTTACACACAATAATGG - Intronic
1028708492 7:93879447-93879469 GGTACATATAAAGACAATAAAGG + Intronic
1028833240 7:95347797-95347819 GGTCCTTTTAAATTCAATAAAGG - Intergenic
1030257925 7:107531698-107531720 AATTGATTTAAACATAATAAGGG + Intronic
1030328523 7:108247946-108247968 GTTCCATTTAAAAACAAAAATGG + Intronic
1031318753 7:120293210-120293232 AATCCAATTAAACAGACTAATGG - Intronic
1032525024 7:132573543-132573565 GATCCTTTTCATCACAATGAGGG - Intronic
1033298123 7:140159748-140159770 GACCCATATAACCACAAGAATGG + Intronic
1036908259 8:12726757-12726779 GACTCATTTAAAAACAACAAAGG + Intronic
1038466482 8:27769467-27769489 TATCCATATAAACCCAACAATGG - Intronic
1040847932 8:51864288-51864310 GATCGACTGAAATACAATAATGG + Intronic
1041971829 8:63752278-63752300 TATGCATTTAAAGACAAGAAGGG + Intergenic
1042585672 8:70335469-70335491 TGTCCATTTAAACAGAATCATGG - Intronic
1042615954 8:70649379-70649401 GATGCATTTAAACACCCTAAGGG + Intronic
1043550851 8:81371124-81371146 GGTCCATTTGAGAACAATAAAGG + Intergenic
1043865531 8:85370866-85370888 GATCCATTTAAACACAATAATGG - Intronic
1043873495 8:85461157-85461179 TATCTACTTAAACACTATAATGG + Intergenic
1044290563 8:90463915-90463937 AATCCAATTAAAAACAACAATGG - Intergenic
1047237223 8:123052375-123052397 GAAACATTTAAGCAGAATAAAGG - Intronic
1047452961 8:124983171-124983193 GATCCATTCAGTCACAAAAATGG - Intergenic
1054721888 9:68612077-68612099 GATTCATTTTAACAAATTAAGGG + Intergenic
1056366771 9:85912836-85912858 GATACATTTATAAACAAAAATGG + Intergenic
1056442143 9:86631966-86631988 GAGCTATTTAAAAATAATAAAGG + Intergenic
1058298270 9:103336689-103336711 GCCCCATTTGTACACAATAATGG - Intergenic
1058757118 9:108093361-108093383 GATCAATGTAAACAAAATATTGG - Intergenic
1059725639 9:117005870-117005892 GATTCAATTAAACACCACAATGG - Intronic
1060099494 9:120826368-120826390 AATCTATCTCAACACAATAAAGG - Intronic
1188322456 X:28756696-28756718 GTTCCAATTAAACAGAAAAATGG - Intronic
1194110981 X:89834593-89834615 TATCAATTTAAACTCAATAATGG + Intergenic
1194136896 X:90155875-90155897 AATACATTTCAACAAAATAAGGG + Intergenic
1194188037 X:90798032-90798054 AATTTATTTAAACACAATTATGG + Intergenic
1194262894 X:91718914-91718936 GATGAATGTCAACACAATAATGG + Intergenic
1194719306 X:97322176-97322198 GACCCCTTTGAAGACAATAAAGG + Intronic
1194730660 X:97449965-97449987 GATCCACTTAAAAAAAAAAAAGG - Intronic
1196554762 X:117073594-117073616 GACCCAAATAAACACAATTAGGG + Intergenic
1197527422 X:127579626-127579648 GAACCAATTAAAAATAATAATGG - Intergenic
1197959089 X:131984458-131984480 AATACATTTAAAAACAATTAAGG + Intergenic
1198967866 X:142245825-142245847 AATGGATTTTAACACAATAAAGG + Intergenic
1199211840 X:145221367-145221389 GATGCATCTATACAAAATAAAGG - Intergenic
1199483168 X:148320832-148320854 AATACATTTTAAAACAATAAAGG - Intergenic
1200463640 Y:3489337-3489359 TATCAATTTAAACTCAATAATGG + Intergenic
1200534629 Y:4379978-4380000 AATTTATTTAAACACAATTATGG + Intergenic
1200769385 Y:7109387-7109409 TATCTATTTAGACACAATTAGGG + Intergenic