ID: 1043865532

View in Genome Browser
Species Human (GRCh38)
Location 8:85370903-85370925
Sequence TTTACATTTGCATACTATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043865531_1043865532 14 Left 1043865531 8:85370866-85370888 CCATTATTGTGTTTAAATGGATC No data
Right 1043865532 8:85370903-85370925 TTTACATTTGCATACTATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043865532 Original CRISPR TTTACATTTGCATACTATTC TGG Intronic