ID: 1043865533

View in Genome Browser
Species Human (GRCh38)
Location 8:85370914-85370936
Sequence ATACTATTCTGGATACTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043865531_1043865533 25 Left 1043865531 8:85370866-85370888 CCATTATTGTGTTTAAATGGATC No data
Right 1043865533 8:85370914-85370936 ATACTATTCTGGATACTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043865533 Original CRISPR ATACTATTCTGGATACTTCT AGG Intronic