ID: 1043871476

View in Genome Browser
Species Human (GRCh38)
Location 8:85438496-85438518
Sequence TGCATTCTTGGGGATGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 406}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043871476_1043871490 6 Left 1043871476 8:85438496-85438518 CCCACCCCATCCCCAAGAATGCA 0: 1
1: 0
2: 1
3: 31
4: 406
Right 1043871490 8:85438525-85438547 AAGGAGAGAGGACGAGGTGAGGG No data
1043871476_1043871489 5 Left 1043871476 8:85438496-85438518 CCCACCCCATCCCCAAGAATGCA 0: 1
1: 0
2: 1
3: 31
4: 406
Right 1043871489 8:85438524-85438546 GAAGGAGAGAGGACGAGGTGAGG No data
1043871476_1043871488 0 Left 1043871476 8:85438496-85438518 CCCACCCCATCCCCAAGAATGCA 0: 1
1: 0
2: 1
3: 31
4: 406
Right 1043871488 8:85438519-85438541 TGGAGGAAGGAGAGAGGACGAGG No data
1043871476_1043871492 29 Left 1043871476 8:85438496-85438518 CCCACCCCATCCCCAAGAATGCA 0: 1
1: 0
2: 1
3: 31
4: 406
Right 1043871492 8:85438548-85438570 CCGCCTGCATTTCTGCACGTCGG No data
1043871476_1043871487 -6 Left 1043871476 8:85438496-85438518 CCCACCCCATCCCCAAGAATGCA 0: 1
1: 0
2: 1
3: 31
4: 406
Right 1043871487 8:85438513-85438535 AATGCATGGAGGAAGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043871476 Original CRISPR TGCATTCTTGGGGATGGGGT GGG (reversed) Intronic
900421701 1:2558589-2558611 TGCATCCATGGAGATGGGGTTGG - Intronic
900477318 1:2882090-2882112 TGCATACTGGGGGCTGTGGTGGG - Intergenic
901651235 1:10744299-10744321 AGACTTCTTGGGGGTGGGGTGGG + Intronic
901987598 1:13088514-13088536 TGAATTCTTGGGGGTTGAGTGGG - Intergenic
901994214 1:13138253-13138275 TGAATTCTTGGGGGTTGAGTGGG + Intergenic
902204861 1:14860883-14860905 TGCATTTTTGGCACTGGGGTTGG + Intronic
902802249 1:18837889-18837911 TGAAAGCTTGGGGCTGGGGTGGG + Intergenic
903709595 1:25312997-25313019 TGCATTTTGGGGGCTGGGGCAGG + Intronic
904283028 1:29434607-29434629 TGCATTGCTGGGGAAGGAGTGGG - Intergenic
906207898 1:43996837-43996859 TTGTTTCTGGGGGATGGGGTGGG - Intronic
906723311 1:48024967-48024989 TGCTTTAGGGGGGATGGGGTGGG - Intergenic
906840597 1:49134480-49134502 TGCATTCCTGGGGTGGGGGGGGG - Intronic
906901624 1:49842597-49842619 TACATTCTTGGTGAGGGAGTGGG + Intronic
909113965 1:71510826-71510848 TCCATTCTTTGGGTTTGGGTGGG + Intronic
909196504 1:72633031-72633053 TGCTTGCCTGGGGATGAGGTAGG - Intergenic
910259697 1:85283598-85283620 TGCAATCTTGGTGATGGCGTGGG + Intergenic
910506555 1:87955886-87955908 TGCATTGGTGGGGAGGGGATAGG + Intergenic
913355738 1:117919866-117919888 TGGTTGCTTGGGGATGGGGAGGG + Intronic
913679008 1:121170924-121170946 TTCATTCTTAGGGTGGGGGTGGG - Intronic
913978796 1:143488910-143488932 TGAATTCTGTGGGCTGGGGTGGG + Intergenic
914030840 1:143958570-143958592 TTCATTCTTAGGGTGGGGGTGGG - Intronic
914158609 1:145109392-145109414 TTCATTCTTAGGGTGGGGGTGGG + Intronic
914914445 1:151810271-151810293 GGCATTCATGGGGGTGGGGCAGG - Intronic
914989468 1:152485879-152485901 TCCATTCTTTGGGATTGGATGGG - Intergenic
915053540 1:153103349-153103371 TGCATTGGCAGGGATGGGGTTGG - Intronic
915438510 1:155928080-155928102 TACATTCTTGGGGCTGGGCACGG + Intronic
915770166 1:158412963-158412985 TGCATTTTTGTTGATGGGGAAGG + Intergenic
915848921 1:159299967-159299989 TGCTTTTTTGGGGTGGGGGTGGG + Intronic
916602052 1:166302750-166302772 TACATTCTGATGGATGGGGTAGG + Intergenic
917200097 1:172505751-172505773 TGCCTTATTGGTGTTGGGGTTGG - Intergenic
917213769 1:172657199-172657221 TACAGGGTTGGGGATGGGGTGGG + Intergenic
917303247 1:173601093-173601115 TTCCTTCTTGGGGTTGGGGTGGG + Intronic
917395060 1:174584624-174584646 ATCATTCTTGGTGATGGGCTTGG + Intronic
917964759 1:180171426-180171448 TTCAGTCTTGGGGATGGTGGGGG + Intronic
918080416 1:181203609-181203631 GGCATGCTTGGGGGTGTGGTTGG - Intergenic
918171697 1:182003920-182003942 TGCTTTCTTGGGCGCGGGGTTGG + Intergenic
918279651 1:182991240-182991262 TTAATTCTTGGGAATGGTGTGGG + Intergenic
920466308 1:206189462-206189484 TTCATTCTTAGGGTGGGGGTGGG - Intronic
921111403 1:212041496-212041518 TGCATTTTTGGCGGGGGGGTGGG + Intronic
921190436 1:212703569-212703591 TACATCTTTGGGGAGGGGGTAGG + Intergenic
921382792 1:214542431-214542453 GGCATTCTTGGGCAAGGGGAAGG + Intronic
922564619 1:226593610-226593632 TCCTTTCTGGGGGATGAGGTTGG - Intronic
922967899 1:229707222-229707244 TGCATTCCTGGGGGAGGGGGGGG + Intergenic
923091337 1:230743566-230743588 TGCAGTGTGGAGGATGGGGTGGG - Intergenic
923218376 1:231871017-231871039 TGCACTGTTGGGGATGTGGTGGG + Intronic
923765443 1:236888902-236888924 TTCCTTCTTGGGCAGGGGGTGGG + Intronic
923871111 1:237995220-237995242 TACATTCTGGGGGAGGGTGTGGG + Intergenic
1063748614 10:8916286-8916308 TGGTTGCCTGGGGATGGGGTAGG + Intergenic
1063968543 10:11365212-11365234 TGCAGTGTTGTGTATGGGGTAGG + Intergenic
1064447128 10:15405692-15405714 TGCAGGGTTGGGGATGAGGTGGG + Intergenic
1064713045 10:18145994-18146016 AGAGTTCTTGGGGATGGGGGTGG - Intronic
1067429398 10:46233170-46233192 TGCATTCTAGTAGATGGGGGAGG + Intergenic
1068637453 10:59362931-59362953 TCCATCCCTGGGGGTGGGGTGGG - Intronic
1069629956 10:69891574-69891596 AGCATGCCTGGGAATGGGGTAGG - Intronic
1069757545 10:70782395-70782417 TACATCCCTGGGGATGGGGATGG + Intronic
1069836894 10:71314882-71314904 TGGATTCTACGGGATGGGGGCGG + Intergenic
1070718072 10:78737014-78737036 TGCTTTCTATGGGCTGGGGTGGG - Intergenic
1070783375 10:79149992-79150014 TGCTTTCTGGGGGCTGGAGTGGG - Intronic
1071264607 10:83953787-83953809 TGGCTTCTTGGAGAAGGGGTGGG - Intergenic
1071565053 10:86667420-86667442 GTCTTTCTTGGGGAAGGGGTTGG + Intergenic
1072708499 10:97699651-97699673 TGCTTTTTTTGGGGTGGGGTAGG + Intergenic
1073563457 10:104516356-104516378 GGCATACTTGGTGTTGGGGTGGG - Intergenic
1075659680 10:124184691-124184713 TCCATTCTAGTGGATGGGGCTGG + Intergenic
1075906311 10:126084762-126084784 CGCAGGCTTGGGGATGGGGAGGG - Intronic
1076438482 10:130462885-130462907 TGCAGTGGTGGGGGTGGGGTGGG + Intergenic
1076820146 10:132934261-132934283 TGCCTTCGTGGGCACGGGGTGGG - Intronic
1078051623 11:7970144-7970166 GGCAGTTTTGGGGAAGGGGTGGG + Intergenic
1078271870 11:9803477-9803499 TTTATTATTGGGGATGGGGCTGG - Intronic
1078395828 11:10981080-10981102 TGTATTCTTGAGAATGGGGCAGG + Intergenic
1078515445 11:12018089-12018111 TGCCTTCCTGTGGATGTGGTTGG + Intergenic
1079103742 11:17557606-17557628 TGCAATGTGGGGCATGGGGTAGG + Intronic
1079330548 11:19529483-19529505 AGAATTACTGGGGATGGGGTGGG - Intronic
1079460985 11:20677712-20677734 TCCATAATTGGGGGTGGGGTTGG + Intronic
1079542012 11:21587847-21587869 AGCATTATTGGGGGTGGGGCAGG + Intergenic
1080633545 11:34103780-34103802 TGTATTGTTTGGGGTGGGGTTGG + Intergenic
1080742012 11:35074726-35074748 TGGTTACATGGGGATGGGGTAGG + Intergenic
1080885485 11:36363781-36363803 GGCATTCTTGTGGGAGGGGTGGG - Intronic
1080895469 11:36445789-36445811 TTCAATTGTGGGGATGGGGTAGG - Intronic
1083302782 11:61747618-61747640 TGCATTGTTGGGGAGGGAGGTGG - Intergenic
1083606333 11:63981055-63981077 TGCATTTGTGGGGATGGGTGGGG + Intronic
1083822460 11:65181163-65181185 TGCATCCTATGGGATGGGGTTGG - Intronic
1083837283 11:65279270-65279292 GGCAGACTTGGAGATGGGGTGGG + Intronic
1084024062 11:66436969-66436991 TAGATTCTAGAGGATGGGGTGGG - Intronic
1084114387 11:67033347-67033369 GGCAGTCTAGGGGGTGGGGTGGG - Intronic
1084434880 11:69132953-69132975 TGGTTTCTAGGGGCTGGGGTGGG - Intergenic
1086261357 11:84945272-84945294 AGCGTTCTTGGGCTTGGGGTTGG - Intronic
1087180712 11:95139704-95139726 TGTTTTCTTGGTGATGGGATGGG + Intergenic
1088509612 11:110561057-110561079 TGCCTTCTTGGGGATAGACTAGG + Intergenic
1088679996 11:112231834-112231856 TGCATTTATGGGGCAGGGGTTGG + Intronic
1088704336 11:112448094-112448116 TGCACCCTTGGGGGTGGGGAAGG - Intergenic
1089508228 11:118979208-118979230 TGCATTTTTGGGGATGGGAGTGG + Intronic
1089627816 11:119762624-119762646 TTCAATGTTGGGGGTGGGGTGGG + Intergenic
1089807375 11:121103544-121103566 TACTTTCTTGGAGCTGGGGTAGG - Intronic
1091059960 11:132452113-132452135 CACATTTTTGGGGATGGGGCAGG - Intronic
1091212309 11:133872601-133872623 TGCATTTTTGGCTATGGAGTGGG - Intergenic
1091216446 11:133905237-133905259 TCCAGGCTTGGGGGTGGGGTGGG - Intergenic
1091545906 12:1501111-1501133 TGACCTCTTGGGGATGGGGTGGG - Intergenic
1092701111 12:11231935-11231957 AGCATTAGTGGGGCTGGGGTGGG - Intergenic
1092763334 12:11829259-11829281 TGCATTTTGGGGGGTTGGGTAGG - Intronic
1093061709 12:14614012-14614034 CGCAGTCTTGGGGTTGGGGCAGG + Intronic
1094063511 12:26340139-26340161 TGCATTCAGGGAGATGGGGCTGG - Intronic
1095405819 12:41866092-41866114 TCAAGCCTTGGGGATGGGGTGGG - Intergenic
1096607734 12:52778523-52778545 TTCATTCATAGGGCTGGGGTGGG - Intergenic
1096725980 12:53562896-53562918 TTGACTCTTGGGGGTGGGGTGGG + Intronic
1096749257 12:53748305-53748327 CGCAGTGTTGGGGATGGAGTTGG - Intergenic
1097312312 12:58133567-58133589 TGTATTTTTGGGGATGGGTAAGG - Intergenic
1098061946 12:66572421-66572443 GCCATGCTTGGGGGTGGGGTGGG - Intronic
1098469213 12:70824725-70824747 TGCCTTTGTCGGGATGGGGTTGG + Intronic
1100234666 12:92648702-92648724 TGCATTCTTGGGGACCAGTTGGG - Intergenic
1100310272 12:93388361-93388383 TATATTCTTGGAGGTGGGGTTGG - Intronic
1100904275 12:99279557-99279579 TGCAATCTGTGGGGTGGGGTGGG + Intronic
1101574652 12:105986470-105986492 TCTATTCTTGGGGGTGGGGAGGG - Intergenic
1101757840 12:107635337-107635359 TGTGAGCTTGGGGATGGGGTAGG - Exonic
1102354695 12:112222946-112222968 TGCATTCATGAGGCTGGGGAGGG + Intronic
1102564413 12:113785968-113785990 GGCATTCTGGGAGATGTGGTAGG + Intergenic
1102590031 12:113949976-113949998 TGCATTCTTGGTGGTGGTGATGG + Intronic
1104491469 12:129197277-129197299 TGCCTGCTTGGGGATGAGATTGG - Intronic
1105626492 13:22117854-22117876 TGCATTTGAGGGTATGGGGTGGG + Intergenic
1105758723 13:23493727-23493749 AGCATTCTTGGGGATGGCCAGGG + Intergenic
1106444883 13:29819782-29819804 TTAATTCTTGGGGGTGGGGGCGG - Intronic
1107193943 13:37624306-37624328 TGTTTTCTTGGGGATGGAGGTGG + Intergenic
1107346124 13:39462860-39462882 TTCATTCTTCGGGATGGGGCTGG + Intronic
1107709127 13:43135121-43135143 TGAGTGCGTGGGGATGGGGTGGG - Intergenic
1108181704 13:47846436-47846458 TGGATCCCTGGGGGTGGGGTAGG - Intergenic
1108606920 13:52048802-52048824 TGGTTTCTAGGGGCTGGGGTTGG + Intronic
1108692230 13:52869966-52869988 TGCATTCATGGGGAGGTGATGGG - Intergenic
1109496960 13:63184862-63184884 TGGAATCTTGGGGGTGGGGCGGG - Intergenic
1110679556 13:78292660-78292682 TTCTTTCTTGGGGACAGGGTAGG - Intergenic
1111512760 13:89287690-89287712 TGTCTTGTTGGGGGTGGGGTAGG + Intergenic
1111945208 13:94658004-94658026 TGCAACTTTGGGGATGGGGAGGG - Intergenic
1112169881 13:96960309-96960331 TGCATTTTTGTGGATGGGGAAGG - Intergenic
1112802820 13:103131562-103131584 TGCAGTCCGGGGGATGGGGGTGG - Intergenic
1114553409 14:23547387-23547409 TTCATGATTGGGAATGGGGTGGG + Intronic
1114631960 14:24164848-24164870 TGCATTCCAGGAGATGGGGATGG - Exonic
1114672428 14:24418375-24418397 TGTAGGCTTTGGGATGGGGTTGG - Exonic
1116400198 14:44497228-44497250 TGCACTGCTGGGGCTGGGGTGGG - Intergenic
1117885119 14:60353125-60353147 CCCATTCTTGGGGATGCAGTGGG + Intergenic
1117895753 14:60485312-60485334 TGAAGTTTTGGGGATGGGGTGGG + Intronic
1118043106 14:61938456-61938478 GGCATTCTTGGGGAGGGGATTGG + Intergenic
1121694611 14:95902658-95902680 GGTAATCATGGGGATGGGGTGGG + Intergenic
1122031471 14:98915555-98915577 TGCAGTCTGGGGGCTGGGGAGGG - Intergenic
1122184895 14:99984421-99984443 TTCATCCTTGGGGATGGGGCTGG - Intronic
1124157105 15:27235537-27235559 TGCCTTCCTGGGGCTGGGTTTGG + Intronic
1124220469 15:27846364-27846386 TGCATTCTTGGGGCTGAGCAGGG - Intronic
1125454224 15:39841326-39841348 TGTATTTTTTGGGGTGGGGTGGG - Intronic
1127316265 15:57797024-57797046 TGCATTCGTGGTGCTGGAGTAGG - Intergenic
1128306316 15:66601214-66601236 AGAATTGGTGGGGATGGGGTTGG - Intronic
1128370484 15:67035805-67035827 TGCCATCTTGGGCATGGGATGGG + Intergenic
1128447539 15:67777149-67777171 TGCTTGCTTGAGGGTGGGGTGGG + Intronic
1129153884 15:73705527-73705549 TTCCATCTTGGGGAAGGGGTGGG - Intronic
1129697830 15:77750604-77750626 TCCATTCTTCTGGAAGGGGTTGG - Intronic
1130167739 15:81480935-81480957 TGGGCTCTTGGGGATGGGGTGGG - Intergenic
1130293487 15:82625294-82625316 GGCATACTTGGGGGTGGGGGTGG - Intronic
1131266059 15:90916073-90916095 TGCCTGCTTGGGGGTGGGGGCGG + Intronic
1131681045 15:94723845-94723867 TGCAGTGTTGGGGAAGGAGTAGG - Intergenic
1131683008 15:94743713-94743735 TGCACTTTATGGGATGGGGTGGG + Intergenic
1132481263 16:167259-167281 TGCAGCCCTGGGGATGAGGTCGG + Intergenic
1132727345 16:1344717-1344739 TGCTGTCCTGGGGCTGGGGTCGG + Intronic
1133221685 16:4321638-4321660 TTCACTCTGGTGGATGGGGTGGG + Intronic
1134305452 16:13028037-13028059 TGGCTGCTTGGGGCTGGGGTGGG + Intronic
1135286618 16:21199022-21199044 TGGATTCTTGGGGTTGGGTGTGG + Intronic
1136800128 16:33062388-33062410 GGCCTTGGTGGGGATGGGGTAGG - Intergenic
1137958738 16:52859940-52859962 TGCATGCTTCTGCATGGGGTGGG - Intergenic
1138030269 16:53554246-53554268 TGCATCCTGGGGGTTGTGGTAGG + Intergenic
1138215280 16:55199423-55199445 TGGAGTCATGGGAATGGGGTTGG + Intergenic
1138264312 16:55649399-55649421 TTCATCCTTGCTGATGGGGTTGG - Intergenic
1139261890 16:65602039-65602061 GGGATTCTTGGGGGTGGGGTAGG + Intergenic
1139470658 16:67176503-67176525 AGCATTGATGGGGATGGGGGTGG - Exonic
1140203956 16:72918288-72918310 TGCATTCAGGAGGATGGGGACGG + Intronic
1140506764 16:75478503-75478525 TGCCTACTTGGGGAGGGGGAGGG + Exonic
1140768797 16:78184281-78184303 TGAATTTACGGGGATGGGGTGGG + Intronic
1141514284 16:84533062-84533084 TGCATTTTTGTTGATGGGGACGG - Intronic
1141534851 16:84672121-84672143 TGGATGCTTAGGGCTGGGGTGGG + Intergenic
1142156015 16:88533222-88533244 TCCAGTCCTGGCGATGGGGTGGG - Exonic
1143090665 17:4447598-4447620 TGGAATTTTGGGGGTGGGGTGGG + Intronic
1143304563 17:5935865-5935887 GGCCATCTTAGGGATGGGGTCGG + Intronic
1143845716 17:9771578-9771600 GGCGGCCTTGGGGATGGGGTTGG + Exonic
1144976713 17:19143031-19143053 TGGATTCATGGGCAGGGGGTGGG - Intronic
1145167343 17:20624626-20624648 TGGATTCTTGGTGATGGGCAAGG - Intergenic
1146124884 17:30223736-30223758 TGCATTCTTGAGCCTGGGGTGGG - Intronic
1146929213 17:36765923-36765945 TGGCTCCCTGGGGATGGGGTGGG + Intergenic
1148330714 17:46812333-46812355 TACATTCTTGGGGCGGGGGTAGG - Intronic
1148676852 17:49450816-49450838 TGCCTTCCTGGGGGTGGGTTTGG - Intronic
1149419813 17:56499056-56499078 TGCATCTCTGGGGATGGGGGTGG - Intronic
1149588282 17:57808332-57808354 TCCATGGATGGGGATGGGGTGGG - Intergenic
1150480687 17:65506917-65506939 TGCATAATTGGGGGGGGGGTTGG + Intergenic
1150485342 17:65539244-65539266 TCCTTTCTTTGGGCTGGGGTGGG + Intronic
1150850242 17:68697198-68697220 TTCATTCTTGGCTATGGGTTGGG - Intergenic
1151127601 17:71861900-71861922 TGAATTTTTGGGGTTGGGGGGGG - Intergenic
1151347042 17:73508502-73508524 TGCCTTTTTGTGGATAGGGTGGG + Intronic
1151511450 17:74563081-74563103 GGCATCCATTGGGATGGGGTTGG - Intergenic
1152856054 17:82664916-82664938 TGCAGGCTTGGGGAGGAGGTGGG - Intronic
1153263412 18:3245940-3245962 TGCTACCTTGGGGATGGGGGCGG - Intergenic
1153273698 18:3348132-3348154 TTCAGTCTTGGGGAAGGGATTGG - Intergenic
1154311857 18:13273116-13273138 TGCATCTGTGGTGATGGGGTGGG + Intronic
1154472675 18:14720363-14720385 TGTTTTGTAGGGGATGGGGTAGG + Intergenic
1155346730 18:24864883-24864905 TGCCTTCTAGGGGGTTGGGTAGG - Intergenic
1155624255 18:27816254-27816276 TGTATTCTTTGAGATGGGGCTGG + Intergenic
1155958087 18:31970823-31970845 TGCATACGTGGGGGTGGGGCAGG - Intergenic
1156098653 18:33566381-33566403 TGCAGTCATTGGGGTGGGGTGGG + Intergenic
1156481146 18:37437197-37437219 TTCTTTCTTGGGCATGGGGTGGG - Intronic
1156770000 18:40708712-40708734 TGCATGCTAGGGGAAGGGGTGGG + Intergenic
1158368816 18:56772956-56772978 GCCATACTTGGGGATGGGGCAGG + Intronic
1158420032 18:57285189-57285211 TGCATATGTGGGGGTGGGGTGGG - Intergenic
1159015735 18:63100439-63100461 TGGCTTTTTGGGGGTGGGGTGGG + Intergenic
1159036794 18:63285436-63285458 TGCATTCTTGGGGAGATGTTGGG - Intronic
1159897938 18:74014497-74014519 AGCATTCTTTGTGAAGGGGTGGG + Intergenic
1160760197 19:780182-780204 TGGATTCTCAGGGATGGGGAGGG - Intergenic
1161202318 19:3022354-3022376 TGTATTTTTGTAGATGGGGTGGG - Intronic
1161278932 19:3434646-3434668 TGCATTCTTCTGGGTGGGGAGGG - Intronic
1161458963 19:4385241-4385263 TGGCTTCCTTGGGATGGGGTGGG + Intronic
1162717692 19:12644264-12644286 TAAGTCCTTGGGGATGGGGTGGG - Intronic
1164210451 19:23093535-23093557 CTCATTCTTGGGGGTGGGGGTGG + Intronic
1165065553 19:33226043-33226065 TCCATTCTTGGGGCCGGGTTGGG + Intergenic
1166213691 19:41322743-41322765 TGCCTTGTTGGGGATGGGGATGG - Exonic
1167142894 19:47664565-47664587 TGCTTCCGTGGGGATGGGGAGGG + Intronic
1168278650 19:55291664-55291686 TGTGTTTTTGGAGATGGGGTGGG + Intronic
1168494955 19:56840346-56840368 TGCCTTTTTGGGGCAGGGGTGGG - Intronic
925046884 2:778953-778975 TACATTCCTGGGGGTGGGGATGG - Intergenic
926677434 2:15638053-15638075 TGCCTGCTTGGGGTTGGGTTTGG + Intergenic
927642291 2:24852824-24852846 TGAAGTCCTGGGGATGGGCTCGG - Intronic
927980848 2:27374242-27374264 TTCATTCTGGGGGTGGGGGTGGG - Intronic
928301526 2:30129670-30129692 TGCATGCTCAGGCATGGGGTGGG - Intergenic
929901055 2:46004220-46004242 TTCATCCTTTTGGATGGGGTTGG + Intronic
930173777 2:48280252-48280274 TTCATTCTGGTAGATGGGGTTGG - Intergenic
932714359 2:74090653-74090675 TGCTGTCTTGGGGCTGGGGGAGG - Intronic
933147514 2:78872686-78872708 TTAAATTTTGGGGATGGGGTGGG + Intergenic
933917592 2:87011823-87011845 TGAATTATTGGGGATGGAGGAGG + Intronic
934005404 2:87758094-87758116 TGAATTATTGGGGATGGAGGAGG - Intronic
934090969 2:88550074-88550096 TGGATTCTCGGGGCTGGGGCAGG - Intergenic
934183520 2:89649991-89650013 TGAATTCTGTGGGCTGGGGTGGG + Intergenic
934477797 2:94604592-94604614 TGCTTTATTGGGGAAGGGATGGG - Intergenic
935284319 2:101550605-101550627 TGCATATTAGGGGGTGGGGTAGG - Intergenic
935768363 2:106392186-106392208 TGAATTATTGGGGATGGAGGAGG - Intronic
936672660 2:114676093-114676115 AGCATTCTTAGAGATGGGCTGGG - Intronic
936937497 2:117852289-117852311 TTCTTTGTTGGGGGTGGGGTGGG - Intergenic
937023422 2:118678883-118678905 AGCAGTTTTGGGGGTGGGGTTGG + Intergenic
937572272 2:123379063-123379085 TGCATTATTGGGGTAGGGGGAGG - Intergenic
938378024 2:130821288-130821310 TGGTTTCTAGGGGCTGGGGTGGG - Intergenic
941166668 2:162090452-162090474 TGCTTACATGGGGTTGGGGTTGG - Intergenic
941211970 2:162651364-162651386 GGCCTACTTGGGGGTGGGGTGGG - Intronic
941912473 2:170776920-170776942 AGCCTTCTGGGGGACGGGGTGGG - Intergenic
943047121 2:182872598-182872620 TGCATTCCATGGGATGGGCTGGG - Intergenic
943241545 2:185390578-185390600 TGCATCCGTGGGGACAGGGTTGG - Intergenic
944412166 2:199456383-199456405 TCCATTCATTGGGACGGGGTTGG + Intronic
944540565 2:200749859-200749881 TTCATTCTTGGGCATGAAGTGGG - Intergenic
945226626 2:207537355-207537377 TACATATTTGGGGATGGGGGTGG + Intronic
945466544 2:210175993-210176015 TGGTTTCTTAGGGTTGGGGTGGG + Intergenic
945889638 2:215414882-215414904 TGCATTCCACTGGATGGGGTGGG + Exonic
947368159 2:229417705-229417727 TGCTTTCTTGGGGAGGAGGCAGG - Intronic
947536440 2:230942802-230942824 CCCATTCTTGTGGATGGGGGTGG - Intronic
948886999 2:240889462-240889484 TGCTTCCTCGGGGTTGGGGTGGG + Intronic
1168863712 20:1065439-1065461 TGTCTTCTTGGGGTTGGGGGTGG + Intergenic
1169099177 20:2930990-2931012 AGACTCCTTGGGGATGGGGTTGG + Intronic
1169641824 20:7760862-7760884 TGCATTCCATGGGATGGGCTAGG - Intergenic
1172122696 20:32608121-32608143 TCCATTGTGGGGAATGGGGTGGG - Intronic
1175166297 20:57047101-57047123 TGCATTCCTGAGGCTGGGGGTGG - Intergenic
1175263970 20:57691575-57691597 TGCTTCCTCAGGGATGGGGTAGG + Intronic
1175803439 20:61814001-61814023 TGCATTCTCAGGAATGGGGATGG - Intronic
1176082842 20:63282520-63282542 TGAAGTCTGGAGGATGGGGTTGG + Intronic
1176112465 20:63416858-63416880 TGCTGCCTGGGGGATGGGGTGGG - Intronic
1176122758 20:63461586-63461608 GCCACTCTTGGGGATGGGGGAGG - Intronic
1176215421 20:63945497-63945519 GGCATGCCTGGGGTTGGGGTTGG + Intronic
1176801814 21:13437494-13437516 TGTTTTGTAGGGGATGGGGTAGG - Intergenic
1178013163 21:28310695-28310717 TATATCCTTGGGGATGGAGTTGG + Intergenic
1178305683 21:31488359-31488381 TGTATTCAGGGGGATGGGGAGGG + Intronic
1178398041 21:32259776-32259798 TGAATTCTTGGGATTGGGGGTGG - Intergenic
1178873609 21:36395614-36395636 TGCATGCTAGTTGATGGGGTAGG + Intronic
1179092153 21:38276349-38276371 TCCATTCTTGGGGTAGGGCTGGG + Intronic
1180016888 21:45093056-45093078 TGAATATTTGGGGGTGGGGTGGG - Intronic
1180042315 21:45287163-45287185 TGGAGTCTGGGGGATGGGATGGG - Intronic
1180722822 22:17922096-17922118 TGGCTGCTTGGGGCTGGGGTGGG - Intronic
1181348173 22:22235708-22235730 TCCATTCTTTGGGTTGGGATGGG + Intergenic
1181548223 22:23617489-23617511 TCCATTCTTTGGGATTGGATTGG + Intronic
1181751921 22:24994879-24994901 TGCATCTTTTGGGATGGAGTTGG + Intronic
1183346131 22:37309436-37309458 TGCATCCTGGGGGATGGAGTTGG + Intronic
1183951758 22:41356492-41356514 TGCATGCTCGGGGCTGCGGTCGG + Intronic
1184248358 22:43246860-43246882 TGACTTCGTGGGGATGGGGGCGG + Intronic
1184975976 22:48062358-48062380 CACATTCTTGAGGATGGGGGAGG + Intergenic
1185004663 22:48268644-48268666 TGCTTTCTGGGGGCTGGGGATGG - Intergenic
949708156 3:6842626-6842648 TACAGGCTTGGGGGTGGGGTGGG - Intronic
951091305 3:18576805-18576827 AGGATTCTTTGGGATGGGGCTGG + Intergenic
951638254 3:24804449-24804471 TCCTTTGTTGGGCATGGGGTAGG + Intergenic
953335520 3:42090985-42091007 TGCATTCTTGGGGATAGTCTAGG - Intronic
953471837 3:43174025-43174047 GGTAGTCTTGGGGAAGGGGTTGG - Intergenic
953660928 3:44891003-44891025 TGCCTTCGTGGGGGTGGGGAGGG + Intronic
954471170 3:50696670-50696692 TACTTTTTTGGGGGTGGGGTGGG + Intronic
954565109 3:51593145-51593167 AGGATTGTTGGGGGTGGGGTGGG + Intronic
955136983 3:56228893-56228915 GGCTTTTTGGGGGATGGGGTAGG + Intronic
955212510 3:56955117-56955139 TGAATTTAAGGGGATGGGGTGGG - Intronic
955715192 3:61822240-61822262 TGCATATTTGGGGATGTGGGTGG - Intronic
956478980 3:69653640-69653662 TGAATCCCTAGGGATGGGGTGGG - Intergenic
956667798 3:71658469-71658491 CTCATTCTGGGGGCTGGGGTGGG - Intergenic
956877803 3:73480596-73480618 TGCACTCTGGGTGATGGGGTAGG - Intronic
956902750 3:73733677-73733699 CACATATTTGGGGATGGGGTGGG + Intergenic
957161567 3:76617004-76617026 TTGATTCTTGGGAATAGGGTTGG - Intronic
957338602 3:78863516-78863538 TGCATGCATGGGGTTGGGGAAGG + Intronic
958906955 3:99952427-99952449 GGAATTTTTGGGGCTGGGGTAGG - Intronic
959301376 3:104606511-104606533 TGAAATCCTGGTGATGGGGTAGG + Intergenic
961218329 3:125179297-125179319 TGCATTCTTGGTGGTGGGGTGGG - Intronic
961741621 3:129036535-129036557 TCCATGCTGGGGGATGGGGATGG + Intronic
961851355 3:129822433-129822455 TGTATTTTTTGAGATGGGGTTGG - Intronic
962071130 3:132034796-132034818 TCCATTCTCGGTGATGGGGGTGG + Exonic
963983193 3:151563004-151563026 TGCATTCTAAGGGATGGGCCAGG + Intergenic
967471030 3:189862347-189862369 TTCATTCTCGGGGATGGGGGTGG - Intronic
967645831 3:191922507-191922529 TGCTTTCTCATGGATGGGGTGGG + Intergenic
968551598 4:1226292-1226314 TGCAATCATCCGGATGGGGTGGG - Intronic
969456062 4:7300266-7300288 TCTAATCTCGGGGATGGGGTGGG + Intronic
970902201 4:21172945-21172967 TGCAGTCCTGGGGATGAGGTTGG - Intronic
971026679 4:22595440-22595462 GGCATCCTTGGGGACAGGGTGGG + Intergenic
972636106 4:40885565-40885587 TCCATTCTTGGGGTTTGGATGGG + Intronic
972939236 4:44177279-44177301 CACATTCCTGGGGGTGGGGTGGG - Intronic
974858998 4:67496891-67496913 TGAATTTTTGGGGGTGGGGGTGG - Intronic
979503616 4:121468134-121468156 TGCATTCCTGGGGGGGGGGGGGG - Intergenic
980446442 4:132914997-132915019 TACCATCTTGAGGATGGGGTTGG - Intergenic
981202256 4:141994536-141994558 TGCATTCTGAGGGTTGGGGGAGG - Intergenic
982229367 4:153194559-153194581 TGGATGCTTGGGGATGGAGCTGG + Intronic
983527379 4:168772938-168772960 TGCTCTCTTGGGCATGGAGTGGG + Intronic
984368284 4:178827451-178827473 TTCTTTTTTGGGGGTGGGGTGGG - Intergenic
985384444 4:189430824-189430846 TGCATTCTTATGGATGAGCTGGG + Intergenic
985825624 5:2188798-2188820 TGCTTTCTGGGGTATGGGGAGGG + Intergenic
988481814 5:31638151-31638173 TGCTTTCGGGGGGATGGGGATGG - Intergenic
988612325 5:32738567-32738589 TGCAATTTTGGGGGTGGGGCAGG + Intronic
989111082 5:37907067-37907089 TGCTTTGTTGGGGAGGGAGTTGG + Intergenic
989691658 5:44152176-44152198 TGCAGCCTTTGGGGTGGGGTGGG - Intergenic
990282179 5:54262981-54263003 TGAATTCATTTGGATGGGGTGGG + Intronic
990735132 5:58852236-58852258 TGCATTATGGGGGTTGGGGAAGG - Exonic
991025880 5:62029095-62029117 ATTATTCTTGGGGATGGGGATGG - Intergenic
991630532 5:68652450-68652472 TTCATCCCTAGGGATGGGGTGGG - Intergenic
992413642 5:76532463-76532485 TGCTTTCCTGAGGATTGGGTGGG + Intronic
992984210 5:82210931-82210953 TTCTTTCTTTAGGATGGGGTTGG + Intronic
996038721 5:118787208-118787230 CGTATGCTTGGGGCTGGGGTGGG - Intergenic
997247760 5:132365329-132365351 TGCATTCTACAGGATGGGCTGGG + Intergenic
998139945 5:139694081-139694103 TGCATGACTGGGAATGGGGTGGG + Intergenic
998487020 5:142511813-142511835 AACATTCTTGGCGATGGGGTTGG + Intergenic
998709006 5:144799588-144799610 TGGAGTCTTGAGTATGGGGTTGG + Intergenic
1000017533 5:157291140-157291162 TTTATCCCTGGGGATGGGGTGGG - Intronic
1001568338 5:172714640-172714662 TGCAGCCGTGGGGATGGGGCAGG - Intergenic
1005093864 6:22089594-22089616 TGGTTTCCTGGGGACGGGGTTGG - Intergenic
1005098953 6:22148268-22148290 TGCATTCCTGCGGATGGGGCTGG + Intergenic
1006116406 6:31778235-31778257 TGCATGCCTGGGGCTGGGCTTGG - Intronic
1006448462 6:34092627-34092649 TCCATCCTTGGGGTTGGAGTGGG - Intronic
1006523524 6:34585908-34585930 TGGATTCTGCGGGGTGGGGTGGG + Intergenic
1006782879 6:36644000-36644022 TGCATTCCTGGGGATGCAGCTGG + Intergenic
1007090048 6:39178450-39178472 TGTATTCCTGGGGATGGGAGTGG - Intergenic
1008134458 6:47757592-47757614 TGAGTACTTGGGGGTGGGGTGGG + Intergenic
1009773411 6:68174609-68174631 TGCATGCTTGCAGGTGGGGTAGG + Intergenic
1009774443 6:68187323-68187345 TGCAATGGTGGGGGTGGGGTGGG + Intergenic
1010787431 6:80020912-80020934 CCCCTTCTTGGGGATGGGTTTGG - Intronic
1013536685 6:111068981-111069003 GGCATTCTTGGGCATGCAGTGGG - Intergenic
1013765064 6:113564917-113564939 TGCATTTGTGTGGAGGGGGTGGG - Intergenic
1013775467 6:113674438-113674460 CGCATTCTTGGGCATTGGGTGGG - Intergenic
1014304152 6:119719443-119719465 TTTTTTCTGGGGGATGGGGTGGG + Intergenic
1014689720 6:124548729-124548751 TGCATTCTAGGAGATGGGGAAGG + Intronic
1014927272 6:127287780-127287802 TGCATTTTGGGAGTTGGGGTGGG + Exonic
1015139166 6:129910281-129910303 TGCAGTCTTGGGGAAGAGGAGGG - Intergenic
1015413936 6:132927163-132927185 TCTATTTTGGGGGATGGGGTGGG + Intergenic
1016019683 6:139223328-139223350 TGCATTTATTGGGATGGGGAAGG + Intergenic
1017040889 6:150307824-150307846 TGCATGGCTGGGAATGGGGTGGG + Intergenic
1017905927 6:158757532-158757554 TACTTTCTTGTGGGTGGGGTGGG + Intronic
1018129202 6:160712355-160712377 TGAATTATTGGGGATGGAGGAGG - Intronic
1018429375 6:163711635-163711657 TTCATTCTGGGGGATGGGTGTGG - Intergenic
1018732543 6:166663381-166663403 TGGGTTCTGGGGGCTGGGGTGGG - Intronic
1018801230 6:167223882-167223904 TCCATCTTTGTGGATGGGGTAGG + Intergenic
1018966902 6:168496722-168496744 TGCAATCTTGGAGATGGGCAGGG - Intronic
1019340063 7:504666-504688 TGGGTTCGTGGGGATGGGCTCGG + Intronic
1022478159 7:30725436-30725458 TGCATTCTAGTGGGTGGTGTAGG + Intronic
1022792115 7:33699578-33699600 CCCATGCTTGGGGAGGGGGTGGG - Intergenic
1023131397 7:37006538-37006560 TGCATTCTTGATGAGGGAGTGGG + Intronic
1023140208 7:37094483-37094505 TTTGTGCTTGGGGATGGGGTGGG - Intronic
1023149994 7:37193220-37193242 TGGATTCTTGGTGAGGGGGGAGG + Intronic
1023865202 7:44235105-44235127 TGCCTTCCTGGGGTAGGGGTGGG + Intronic
1024196730 7:47066504-47066526 AGCACTCTTGGCGATGGGGATGG + Intergenic
1024551593 7:50566779-50566801 TCCATTCTAGGAGATGGGCTGGG + Intergenic
1026184919 7:68075072-68075094 GCTGTTCTTGGGGATGGGGTTGG + Intergenic
1027234809 7:76291926-76291948 TGGCTTCGTGGGGAAGGGGTGGG + Intergenic
1028536619 7:91895054-91895076 TGAATTCCTGGGGATGGTGAAGG + Intergenic
1030056774 7:105590101-105590123 TGGTTGCCTGGGGATGGGGTTGG - Intronic
1030937561 7:115603952-115603974 TGGTTTCCTGGGAATGGGGTGGG - Intergenic
1031126073 7:117774619-117774641 TCCATGGTTGGGGGTGGGGTGGG - Intronic
1031136624 7:117891526-117891548 TGCATTCCATGGGATGGGCTGGG + Intergenic
1031484823 7:122313344-122313366 TGCATTATTAGTGATGAGGTGGG - Intergenic
1033164319 7:139026472-139026494 TGGGTGGTTGGGGATGGGGTGGG - Exonic
1033432770 7:141304289-141304311 TGGATGCTTGGGGAAGGGGGTGG + Intronic
1034453069 7:151148290-151148312 TGGACTCCTGGGGAGGGGGTGGG - Intergenic
1034732351 7:153399044-153399066 GGCAAACTTGGGGATGTGGTAGG + Intergenic
1034948897 7:155283571-155283593 TGAATTCTTGGGGAAGGGATAGG + Intergenic
1034978360 7:155460737-155460759 TGCAGATTTGGAGATGGGGTTGG - Intronic
1035838789 8:2788127-2788149 AGCATTTGCGGGGATGGGGTTGG + Intergenic
1036289387 8:7473861-7473883 TGCATTCTTCGGGATCTGGAGGG + Intronic
1036332094 8:7837671-7837693 TGCATTCTTCGGGATCTGGAGGG - Intronic
1037995745 8:23351190-23351212 CGGACTCCTGGGGATGGGGTCGG + Intronic
1038279520 8:26151337-26151359 TGTATTTTTGAGGATGGAGTTGG + Intergenic
1038426037 8:27464520-27464542 GGCAGTTTTGGGGAAGGGGTGGG + Intronic
1039327821 8:36504263-36504285 AACATTCTTTGGGTTGGGGTGGG + Intergenic
1039804199 8:40984762-40984784 TCCATTCCCGGGGGTGGGGTCGG - Intergenic
1040602758 8:48900142-48900164 TGCTTTTTTGCGGTTGGGGTGGG - Intergenic
1043498579 8:80830451-80830473 TGATTTCCTGGGGCTGGGGTGGG + Intronic
1043871476 8:85438496-85438518 TGCATTCTTGGGGATGGGGTGGG - Intronic
1044114277 8:88315099-88315121 TCCATTTTTTGGGATGGGATAGG + Intronic
1044973403 8:97641805-97641827 TGATTCCTTGGGGATGGGGGTGG - Intergenic
1046308669 8:112404050-112404072 TATATTTTTGGGGTTGGGGTGGG + Intronic
1047316358 8:123737469-123737491 TACATTGTTGGGGATGGGTAGGG + Intergenic
1047666521 8:127097497-127097519 TTCAGTATTGGGCATGGGGTGGG - Intergenic
1047953566 8:129955913-129955935 TGCATCCATCGGGATGGGATAGG + Intronic
1049529042 8:143144415-143144437 TCCATTCTTTGGGTTGGGATGGG + Intergenic
1050332361 9:4558225-4558247 TGCATTGTTGGGGATAAGGGTGG - Intronic
1051526199 9:18047605-18047627 TGAGGTCTTGGGGGTGGGGTGGG + Intergenic
1053003969 9:34592294-34592316 TGAATTCTTGGAGATGGAGTTGG - Intergenic
1054925034 9:70580424-70580446 TGCATTGTGGGGGTTGGGGATGG - Intronic
1056450846 9:86715527-86715549 TGCATGCATGGGGAGGGGGCTGG + Intergenic
1057862086 9:98648725-98648747 TTCATTCTGTGGGTTGGGGTTGG - Intronic
1058991930 9:110262431-110262453 TGGTTTCTTGGTGTTGGGGTGGG + Intergenic
1059022603 9:110592766-110592788 TGCATTCAGTGGGATGGGCTGGG + Intergenic
1059045709 9:110863901-110863923 TGATTTGTTGGAGATGGGGTTGG + Intergenic
1060006674 9:120006463-120006485 TGGGTTCTGGGAGATGGGGTGGG - Intergenic
1060467210 9:123917650-123917672 AGGACTTTTGGGGATGGGGTGGG - Intronic
1060818076 9:126645856-126645878 TGCTTTGTGGAGGATGGGGTGGG + Intronic
1061156099 9:128862709-128862731 TGCAGCCTTGGGGGTGGGGCTGG + Intronic
1061645041 9:131994372-131994394 TGCAGTATTGGGGGTGGGGGAGG - Intronic
1062389165 9:136327318-136327340 TGCATTCCCTGGGGTGGGGTGGG + Intergenic
1186086624 X:5997119-5997141 TGCTTTTTTGGGGGTGGGGTTGG + Intronic
1187255154 X:17635577-17635599 TGCATTCTTGGGCATGCAGCAGG - Intronic
1187678446 X:21741611-21741633 TGCAGTCTTAGGGAGGGAGTGGG - Intronic
1189377225 X:40475401-40475423 TGCATTCCAAGGGATGGGCTGGG - Intergenic
1190253853 X:48747856-48747878 TGCATTCCTGGGAATGTGGGAGG - Intergenic
1190307352 X:49092233-49092255 TGGTTGCTTGGGGATGAGGTGGG + Intronic
1190879040 X:54479663-54479685 GGAATTCCTGGGGGTGGGGTGGG + Intronic
1191916038 X:66202161-66202183 TAGATACTTGGGGGTGGGGTGGG + Intronic
1192326230 X:70134444-70134466 TGCTTTCTGGGGGACGGAGTGGG - Intronic
1192785721 X:74333242-74333264 TGAATTCTGGGGGATCAGGTAGG + Intergenic
1194349735 X:92811263-92811285 TTCAGTCTTGGGGCTGGGCTGGG - Intergenic
1194922973 X:99790526-99790548 TGCATTCCTGAGGTTTGGGTAGG + Intergenic
1195526878 X:105901462-105901484 TGCCTTCTGGGGTATGGGGAGGG + Intronic
1196362071 X:114873942-114873964 TGTATTTCTGGGGCTGGGGTTGG - Intronic
1198125441 X:133639046-133639068 TGAATTCTGGGAGATGAGGTTGG - Intronic
1198686731 X:139235509-139235531 GGCATGGTTGGGGATGGGGGAGG + Intergenic
1199652595 X:149961401-149961423 AGCATTCTTGGGGGTAGGATAGG + Intergenic
1200658060 Y:5927868-5927890 TTCAGTCTTGGGGCTGGGCTGGG - Intergenic