ID: 1043873284

View in Genome Browser
Species Human (GRCh38)
Location 8:85459010-85459032
Sequence TCCTTCTTTGGTAAGATGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043873284_1043873290 27 Left 1043873284 8:85459010-85459032 CCTCACATCTTACCAAAGAAGGA No data
Right 1043873290 8:85459060-85459082 AAGCCAGAGACAGGATTAAATGG No data
1043873284_1043873286 3 Left 1043873284 8:85459010-85459032 CCTCACATCTTACCAAAGAAGGA No data
Right 1043873286 8:85459036-85459058 TGAGAGACTCAGAGTCCAAGAGG No data
1043873284_1043873287 4 Left 1043873284 8:85459010-85459032 CCTCACATCTTACCAAAGAAGGA No data
Right 1043873287 8:85459037-85459059 GAGAGACTCAGAGTCCAAGAGGG No data
1043873284_1043873289 18 Left 1043873284 8:85459010-85459032 CCTCACATCTTACCAAAGAAGGA No data
Right 1043873289 8:85459051-85459073 CCAAGAGGGAAGCCAGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043873284 Original CRISPR TCCTTCTTTGGTAAGATGTG AGG (reversed) Intergenic
No off target data available for this crispr