ID: 1043873286

View in Genome Browser
Species Human (GRCh38)
Location 8:85459036-85459058
Sequence TGAGAGACTCAGAGTCCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043873282_1043873286 18 Left 1043873282 8:85458995-85459017 CCACTTGTGATGCTGCCTCACAT No data
Right 1043873286 8:85459036-85459058 TGAGAGACTCAGAGTCCAAGAGG No data
1043873284_1043873286 3 Left 1043873284 8:85459010-85459032 CCTCACATCTTACCAAAGAAGGA No data
Right 1043873286 8:85459036-85459058 TGAGAGACTCAGAGTCCAAGAGG No data
1043873285_1043873286 -9 Left 1043873285 8:85459022-85459044 CCAAAGAAGGATATTGAGAGACT No data
Right 1043873286 8:85459036-85459058 TGAGAGACTCAGAGTCCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043873286 Original CRISPR TGAGAGACTCAGAGTCCAAG AGG Intergenic
No off target data available for this crispr