ID: 1043873289

View in Genome Browser
Species Human (GRCh38)
Location 8:85459051-85459073
Sequence CCAAGAGGGAAGCCAGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043873285_1043873289 6 Left 1043873285 8:85459022-85459044 CCAAAGAAGGATATTGAGAGACT No data
Right 1043873289 8:85459051-85459073 CCAAGAGGGAAGCCAGAGACAGG No data
1043873284_1043873289 18 Left 1043873284 8:85459010-85459032 CCTCACATCTTACCAAAGAAGGA No data
Right 1043873289 8:85459051-85459073 CCAAGAGGGAAGCCAGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043873289 Original CRISPR CCAAGAGGGAAGCCAGAGAC AGG Intergenic
No off target data available for this crispr