ID: 1043873998

View in Genome Browser
Species Human (GRCh38)
Location 8:85464339-85464361
Sequence GGAATCCCCGCGTCCGCCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043873985_1043873998 19 Left 1043873985 8:85464297-85464319 CCGGGGATGTCCCCCTTGCCCCA 0: 1
1: 0
2: 5
3: 20
4: 269
Right 1043873998 8:85464339-85464361 GGAATCCCCGCGTCCGCCGGAGG No data
1043873984_1043873998 27 Left 1043873984 8:85464289-85464311 CCGCGGCGCCGGGGATGTCCCCC 0: 1
1: 0
2: 0
3: 13
4: 77
Right 1043873998 8:85464339-85464361 GGAATCCCCGCGTCCGCCGGAGG No data
1043873994_1043873998 -1 Left 1043873994 8:85464317-85464339 CCAGCTGCGAGGCCACTGTGGAG No data
Right 1043873998 8:85464339-85464361 GGAATCCCCGCGTCCGCCGGAGG No data
1043873991_1043873998 1 Left 1043873991 8:85464315-85464337 CCCCAGCTGCGAGGCCACTGTGG 0: 1
1: 0
2: 0
3: 18
4: 200
Right 1043873998 8:85464339-85464361 GGAATCCCCGCGTCCGCCGGAGG No data
1043873993_1043873998 0 Left 1043873993 8:85464316-85464338 CCCAGCTGCGAGGCCACTGTGGA No data
Right 1043873998 8:85464339-85464361 GGAATCCCCGCGTCCGCCGGAGG No data
1043873990_1043873998 6 Left 1043873990 8:85464310-85464332 CCTTGCCCCAGCTGCGAGGCCAC 0: 1
1: 0
2: 2
3: 17
4: 278
Right 1043873998 8:85464339-85464361 GGAATCCCCGCGTCCGCCGGAGG No data
1043873988_1043873998 8 Left 1043873988 8:85464308-85464330 CCCCTTGCCCCAGCTGCGAGGCC 0: 1
1: 0
2: 0
3: 28
4: 247
Right 1043873998 8:85464339-85464361 GGAATCCCCGCGTCCGCCGGAGG No data
1043873989_1043873998 7 Left 1043873989 8:85464309-85464331 CCCTTGCCCCAGCTGCGAGGCCA 0: 1
1: 0
2: 3
3: 11
4: 216
Right 1043873998 8:85464339-85464361 GGAATCCCCGCGTCCGCCGGAGG No data
1043873987_1043873998 9 Left 1043873987 8:85464307-85464329 CCCCCTTGCCCCAGCTGCGAGGC 0: 1
1: 0
2: 0
3: 19
4: 208
Right 1043873998 8:85464339-85464361 GGAATCCCCGCGTCCGCCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043873998 Original CRISPR GGAATCCCCGCGTCCGCCGG AGG Intronic