ID: 1043875794

View in Genome Browser
Species Human (GRCh38)
Location 8:85484603-85484625
Sequence CAGCAGACACAGATGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043875794_1043875797 -1 Left 1043875794 8:85484603-85484625 CCTGGCTCCATCTGTGTCTGCTG No data
Right 1043875797 8:85484625-85484647 GGTGTTCTGTCTGTTCCACCTGG No data
1043875794_1043875799 9 Left 1043875794 8:85484603-85484625 CCTGGCTCCATCTGTGTCTGCTG No data
Right 1043875799 8:85484635-85484657 CTGTTCCACCTGGTCTTTGGAGG No data
1043875794_1043875802 25 Left 1043875794 8:85484603-85484625 CCTGGCTCCATCTGTGTCTGCTG No data
Right 1043875802 8:85484651-85484673 TTGGAGGTACTAATAACTGAAGG No data
1043875794_1043875798 6 Left 1043875794 8:85484603-85484625 CCTGGCTCCATCTGTGTCTGCTG No data
Right 1043875798 8:85484632-85484654 TGTCTGTTCCACCTGGTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043875794 Original CRISPR CAGCAGACACAGATGGAGCC AGG (reversed) Intergenic
No off target data available for this crispr