ID: 1043875797

View in Genome Browser
Species Human (GRCh38)
Location 8:85484625-85484647
Sequence GGTGTTCTGTCTGTTCCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043875794_1043875797 -1 Left 1043875794 8:85484603-85484625 CCTGGCTCCATCTGTGTCTGCTG No data
Right 1043875797 8:85484625-85484647 GGTGTTCTGTCTGTTCCACCTGG No data
1043875792_1043875797 10 Left 1043875792 8:85484592-85484614 CCTAGGCTAGCCCTGGCTCCATC No data
Right 1043875797 8:85484625-85484647 GGTGTTCTGTCTGTTCCACCTGG No data
1043875789_1043875797 27 Left 1043875789 8:85484575-85484597 CCTCTGTTGTGGGGTGTCCTAGG No data
Right 1043875797 8:85484625-85484647 GGTGTTCTGTCTGTTCCACCTGG No data
1043875796_1043875797 -8 Left 1043875796 8:85484610-85484632 CCATCTGTGTCTGCTGGTGTTCT No data
Right 1043875797 8:85484625-85484647 GGTGTTCTGTCTGTTCCACCTGG No data
1043875793_1043875797 0 Left 1043875793 8:85484602-85484624 CCCTGGCTCCATCTGTGTCTGCT No data
Right 1043875797 8:85484625-85484647 GGTGTTCTGTCTGTTCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043875797 Original CRISPR GGTGTTCTGTCTGTTCCACC TGG Intergenic
No off target data available for this crispr